compositions to facilitate membrane fusion and uses thereof

专利摘要:
The present invention relates in some respects to fusosome methods and compositions that comprise membrane-closed preparations, which comprise a fusogen. In some embodiments, the fusosome can fuse with the target cell, thus delivering complex biological agents to the cytoplasm of the target cell.
公开号:BR112019023323A2
申请号:R112019023323-7
申请日:2018-05-08
公开日:2020-07-21
发明作者:Geoffrey A. Von Maltzahn；Brigham Hartley；Tamar Rose Putiri；Kiana Mahdaviani；Matthew Milnes Dobbin；John Miles Milwid；Michael Travis Mee；Jacob Rosenblum Rubens；Nathan Wilson Stebbins；Molly Krisann Gibson；Neal Francis Gordon；Bo Zhang；Kyle Marvin Trudeau
申请人:Flagship Pioneering Innovations V, Inc.；
IPC主号:

专利说明:

[0001] [0001] This application claims priority to US No. 62 / 502,998, filed on May 8, 2017, US No. 62 / 575,147, filed on October 20, 2017 and US No. 62 / 595,862, filed on December 7 2017, each of which is incorporated here by reference in its entirety. BACKGROUND
[0002] [0002] Complex biological products are promising therapeutic candidates for a variety of diseases. However, it is difficult to supply large biological agents to a cell because the plasma membrane acts as a barrier between the cell and the extracellular space. There is a need in the art for new methods of administering complex biological compounds to a subject's cells. SUMMARY OF THE INVENTION
[0003] [0003] The fusion of membranes is necessary in biological processes as diverse as fertilization, development, immune response and tumorigenesis. The present description provides fusion-based methods for delivering complex biological charge to cells.
[0004] [0004] Thus, the present description provides, in some respects, a fusosome comprising a lipid bilayer, a lumen surrounded by the lipid bilayer and a fusogen. The fusosome can be used, for example, to deliver a charge in the lumen or lipid bilayer to a target cell. The charge includes, for example, therapeutic proteins, nucleic acids and small molecules.
[0005] [0005] This description provides, in some respects, a fososome comprising:
[0006] [0006] (a) a lipid bilayer,
[0007] [0007] (b) a lumen (for example, comprising cytosol) surrounded by the lipid bilayer;
[0008] [0008] (c) an exogenous or overexpressed fusogen, for example, in which the fusogen is disposed in the lipid bilayer,
[0009] [0009] in which the fusosome is derived from a cell of origin; and
[0010] [0010] in which the fusosome has partial or complete nuclear inactivation (for example, nuclear removal).
[0011] [0011] In some modalities, one or more of the following is present:
[0012] [0012] i) the fusosome comprises or consists of a cytobiological;
[0013] [0013] ii) the fusosome comprises an enucleated cell;
[0014] [0014] iii) the fusosome comprises an inactivated nucleus;
[0015] [0015] iv) the fusosome fuses at a higher rate with a target cell than with a non-target cell, for example, at least 1%, 2%, 3%, 4%, 5%, 10% , 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times or 100 times , for example, in an Example 54 trial;
[0016] [0016] v) the fusosome fuses at a higher rate with a target cell than with other fusosomes, for example, at least 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times or 100 times, for example, in an Example 54 trial;
[0017] [0017] vi) the fusosome fuses with the target cells at a rate such that an agent in the fusosome is delivered at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of target cells after 24, 48 or 72 hours, for example, in an Example 54 assay;
[0018] [0018] vii) fusogen is present in a copy number of at least, or not more than, 10, 50, 100, 500, 1,000, 2,000, 5,000,
[0019] [0019] viii) the fusosome comprises a therapeutic agent with a copy number of at least, or no more than 10, 50, 100, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000,
[0020] [0020] ix) the ratio between the number of copies of the fusogen and the number of copies of the therapeutic agent is between 1,000,000: 1 and
[0021] [0021] x) the fusosome comprises a lipid composition substantially similar to that of the original cell or in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA, PC , PE, PG, PI, PS, CE, SM and TAG are between 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65 %, 70% or 75% of the corresponding lipid level in the source cell;
[0022] [0022] xi) the fusosome comprises a proteomic composition similar to that of the source cell, for example, using an Example 42 or 155 assay;
[0023] [0023] xii) the fusosome comprises a lipid-to-protein ratio that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, as measured using an Example assay 49;
[0024] [0024] xiii) the fusosome comprises a protein to nucleic acid ratio (for example, DNA) that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, as measured using an Example 50 assay;
[0025] [0025] xiv) fusosome comprises a lipid to nucleic acid ratio (eg DNA) that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example - example, measured using an Example 51 or 159 assay;
[0026] [0026] xv) the fusosome has a half-life in a subject, for example, in a mouse, within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80%, 90%, 100% of the half-life of a reference cell, for example, the source cell, for example, by an Example 75 test;
[0027] [0027] xvi) the fusosome carries glucose (for example, labeled glucose, for example, 2-NBDG) through a membrane, for example, at least 1%, 2%, 3%, 4%, 5%, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% more (for example, about 11.6% more) than a negative control, for example , a similar fusosome in the absence of glucose, for example, as measured using an assay in example 64;
[0028] [0028] xvii) the fusosome comprises esterase activity in the lumen that is within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90% or 100% of the esterase activity in a reference cell, for example, the parent cell or a mouse embryonic fibroblast, for example, using an Example 66 assay;
[0029] [0029] xviii) the fusosome comprises a level of metabolic activity within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the citrate synthase activity in a reference cell, for example, the source cell, for example,
[0030] [0030] xix) the fusosome comprises a level of respiration (for example, rate of oxygen consumption) within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80%, 90% or 100% of the respiration level in a reference cell, for example, the source cell, for example, as described in Example 69;
[0031] [0031] xx) the fusosome comprises an Annexin-V staining level of a maximum of 18,000, 17,000, 16,000, 15,000, 14,000,
[0032] [0032] xxi) the fusosome has a miRNA content level of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than that of the source cell, for example, by an Example 39 assay;
[0033] [0033] xxii) the fusosome has a soluble protein ratio: not soluble within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80%, 90% or greater than that of the original cell, for example, within 1% to 2%, 2% to 3%, 3% to 4%, 4% to 5%, 5 % to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80% or 80% to 90% of the source cell, for example, by an Example 47 assay;
[0034] [0034] xxiii) the fusosome has an LPS level less than 5%, 1%, 0.5%, 0.01%, 0.005%, 0.0001%, 0.00001% or less of the cell's LPS content of origin, for example, as measured by mass spectrometry, for example, in an Example 48 assay;
[0035] [0035] xxiv) the fusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, phosphorylation of AKT in response to insulin or glucose uptake (for example, marked glucose, for example, 2- NBDG) in response to insulin, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 290%, 100% more than a negative control, for example, an otherwise similar fusosome in the absence of insulin, for example, using an Example 63 assay;
[0036] [0036] xxv) the fusosome targets a tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, peripheral nervous system, skeletal muscle, endothelium, inner ear or eye, when administered to a subject, for example, a mouse, for example, in which at least 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the fusosomes in a population of administered fusosomes are present in the target tissue after 24, 48 or 72 hours, for example, by an Example 87 or 100 assay;
[0037] [0037] xXXxVvi) the fusosome has a level of justacrine signaling of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 90% or 100% higher than the level of justotácrine signaling induced by a reference cell, for example, the source cell or a bone marrow stromal cell (BMSC), for example, by an Example test 71;
[0038] [0038] xXxvii) the fusosome has a paracrine signaling level of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 90%, 100% higher than the level of paracrine signaling induced by a reference cell, for example, the source cell or a macrophage, for example, by an Example 72 test;
[0039] [0039] xxViii) the fusosome polymerizes the actin at a level of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to the level of polymerized actin in a reference cell, for example, the parent cell or a C2C12 cell, for example, by the Example 73 test;
[0040] [0040] xxix) the fusosome has a membrane potential between about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 90%, 100% of the membrane potential of a reference cell, for example, the source cell or a C2C12 cell, for example, by an Example 74 test, or where the fusosome has a potential for membrane of about -20 to -150mV, -20 to - SOmV, - 50 to -100mV or -100 to -150mV;
[0041] [0041] xxx) the fusosome is capable of leaking from blood vessels, for example, at a rate of at least 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the extraction rate of the source cell or a cell of the same type as the source cell, for example, using an Example 57 assay, for example, where the source cell is a neutrophil, lymphocyte, B cell, macrophage or NK cell;
[0042] [0042] xxxi) the fusosome is able to cross a cell membrane, for example, an endothelial cell membrane or the blood-brain barrier;
[0043] [0043] XXxxii) the fusosome is capable of secreting a protein, for example, at a rate of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% larger than a reference cell, for example, an embryonic mouse fibroblast, for example, using an Example 62 assay;
[0044] [0044] XXxxiii) the fusosome meets a pharmaceutical standard or good manufacturing practices (GMP);
[0045] [0045] xxxiv) the fusosome was made in accordance with good manufacturing practices (GMP);
[0046] [0046] XXXV) the fusosome has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens;
[0047] [0047] XXXVi) the fusosome has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants;
[0048] [0048] XXXVii) the fusosome has low immunogenicity, for example, as described here;
[0049] [0049] XXXVIIi) the source cell is selected from a neutrophil, a granulocyte, a mesenchymal stem cell, a bone marrow stem cell, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, myoblast, hepatocyte or neuron, for example, neuronal retinal cell; or
[0050] [0050] XXXxix) the source cell is different from a 293 cell, HEK cell, human endothelial cell or human epithelial cell, monocyte, macrophage, dendritic cell or stem cell.
[0051] [0051] The present description also provides, in some respects, a fusosome comprising:
[0052] [0052] a) a lipid bilayer and a lumen that is miscible with an aqueous solution, for example, water, in which the fusosome is derived from a cell of origin,
[0053] [0053] b) an exogenous or overexpressed fusogen disposed in the lipid bilayer, and
[0054] [0054] Cc) an organelle, for example, a therapeutically effective number of organelles, arranged in the lumen.
[0055] [0055] In some modalities, one or more of the following is present:
[0056] [0056] i) the source cell is selected from an endothelial cell, a macrophage, a neutrophil, a granulocyte, a leukocyte, a stem cell (for example, a mesenchymal stem cell, a marrow stem cell bone, an induced pluripotent stem cell, an embryonic stem cell), a myeloblast, a myoblast, a hepatocyte or a neuron, for example, neuronal retinal cell;
[0057] [0057] ii) the organelle is selected from a Golgi complex, lysosome, endoplasmic reticulum, mitochondria, vacuole, endosome, acrosome, autophagosome, centriole, glucosome, glyoxysome, hydrogensome, melanosome, mitosome, cnidocyst, peroxisome, proteasome, vesicle and stress granule;
[0001] [0001] iii) fusosome is larger than 5 µm, 10 µm, 20 µm, 50 µm or 100 µm;
[0002] [0002] i) fusosome, or a composition or preparation that comprises a plurality of fusosomes, has a different density of 1.08 g / ml and 1.12 g / ml, for example, the fusosome has a density - 1.25 g / ml +/- 0.05, for example, as measured by an Example 33 test;
[0003] [0003] iv) fusosome is not captured by the circulating sequestering system or by the Kupffer cells in the liver;
[0058] [0058] v) the source cell is different from a 293 cell;
[0059] [0059] vi) the cell of origin is not transformed or immortalized;
[0060] [0060] vii) the source cell is transformed or immortalized using a different method than adenovirus-mediated immortalization, for example, immortalized by spontaneous mutation or telomerase expression;
[0061] [0061] viii) fusogen is not VSVG, a SNARE protein or a granular secreting protein;
[0062] [0062] ix) the fusosome does not comprise Cre or GFP, for example, EGFP;
[0063] [0063] x) the fusosome further comprises an exogenous protein other than Cre or GFP, eg EGFP
[0064] [0064] xi) the fusosome further comprises an exogenous nucleic acid (for example, RNA, for example, MRNA, miRNA or siRNA) or an exogenous protein (for example, an antibody, for example, an antibody), for example , in the lumen; or
[0065] [0065] xii) the fusosome does not comprise mitochondria.
[0066] [0066] The present description also provides, in some respects, a fusosome comprising:
[0001] [0001] a lipid bilayer,
[0002] [0002] a lumen (for example, comprising cytosol) surrounded by the lipid bilayer,
[0003] [0003] an exogenous or overexpressed fusogen, for example, in which the fusogen is disposed in the lipid bilayer, and
[0004] [0004] a functional core,
[0067] [0067] in which the fusosome is derived from a cell of origin.
[0068] [0068] In some modalities, one or more of the following is present:
[0069] [0069] i) the cell of origin is different from a dendritic cell or tumor cell, for example, the cell of origin is selected from an endothelial cell, a macrophage, a neutrophil, a granulocyte, a leukocyte, a cell- stem (for example, a mesenchymal stem cell, bone marrow stem cell, induced pluripotent stem cell, embryonic stem cell), myeloblast, myoblast, hepatocyte or neuron, for example example, neuronal retinal cell;
[0070] [0070] ii) fusogen is not a fusogenic glycoprotein;
[0071] [0071] iii) fusogen is a mammalian protein other than fertilin-beta,
[0072] Iv) the fusosome has low immunogenicity, for example, as described herein;
[0073] [0073] v) the fusosome meets a pharmaceutical standard or good manufacturing practices (GMP);
[0074] [0074] vi) the fusosome was made in accordance with good manufacturing practices (GMP);
[0075] [0075] vii) the fusosome has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens; or
[0076] [0076] viii) the fusosome has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants.
[0077] [0077] The present description also provides, in some aspects, a purified fusosome composition comprising a plurality of fusosomes, in which at least one fusosome comprises: a) a lipid bilayer and an aqueous lumen, in which the fusosome is derived from a cell of origin, and b) an exogenous or overexpressed fusogen disposed in the lipid bilayer,
[0078] [0078] where the fusosome is at a temperature of less than 4.0, -4, -10, -12, -16, -20, -80 or -160 C.
[0079] [0079] The present description also provides, in some respects, a purified fusosome composition comprising a plurality of fusosomes, wherein at least one fusosome comprises: a) a lipid bilayer and an aqueous lumen, and b) a exogenous or overexpressed protein fusogen disposed in the lipid bilayer,
[0080] [0080] where the fusosome is at a temperature below 4.0, -4, -10, -12, -16, -20, -80 or -160 C.
[0081] [0081] This description also provides, in some respects,
[0082] [0082] The present description also provides, in some respects, a fusosome composition that comprises a plurality of fusosomes derived from a cell of origin, wherein the fusosomes of the plurality comprise:
[0001] [0001] a lipid bilayer,
[0002] [0002] a lumen comprising cytosol, in which the lumen is surrounded by the lipid bilayer;
[0003] [0003] an exogenous or overexpressed fusogen disposed in the lipid bilayer,
[0004] [0004] one charge; and
[0083] [0083] in which the fusosome does not comprise a nucleus;
[0084] [0084] in which the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein;
[0085] [0085] in which the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a reference cell population of reference not treated with the endocytosis inhibitor, delivers the load to at least 30% of the number of cells in the target cell population compared to the reference target cell population.
[0086] [0086] The present description also provides, in some respects, a fusosome composition that comprises a plurality of fusosomes derived from a cell of origin and wherein the fusosomes of the plurality comprise:
[0001] [0001] a lipid bilayer,
[0002] [0002] a lumen comprising cytosol, in which the lumen is surrounded by the lipid bilayer;
[0003] [0003] an exogenous redirected or overexpressed fusogen arranged in the lipid bilayer;
[0004] [0004] one charge; and
[0087] [0087] in which the fusosome does not comprise a nucleus;
[0088] [0088] in which the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein;
[0089] [0089] where:
[0090] [0090] (i) when the plurality of fusosomes is brought into contact with a population of cells comprising target cells and non-target cells, the charge is present at least 2 times, 5 times, 10 times, 20 times, 50 times or 100 times more target cells than non-target cells, or
[0091] [0091] (ii) the fusosomes of the plurality fuse at a higher rate with a target cell than with a non-target cell by at least 50%.
[0092] [0092] The present description also provides, in some respects, a fusosome composition that comprises a plurality of fusosomes derived from a cell of origin and wherein the fusosomes of the plurality comprise:
[0001] [0001] a lipid bilayer,
[0002] [0002] a lumen surrounded by the lipid bilayer;
[0003] [0003] an exogenous or overexpressed fusogen, in which the fusogen is disposed in the lipid bilayer; and
[0004] [0004] one charge;
[0093] [0093] in which the fusosome does not comprise a nucleus; and
[0094] [0094] where one or more of (for example, at least 2, 3, 4 or de):
[0095] [0095] i) fusogen is present in a number of copies of at least 1,000 copies;
[0096] [0096] ii) the fusosome comprises a therapeutic agent with a copy number of at least 1,000 copies;
[0097] [0097] iii) the fusosome comprises a lipid in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA, PC, PE, PG, PI, PS, CE, SM and TAG are within 75% of the corresponding lipid level in the source cell;
[0098] [0098] iv) the fusosome comprises a proteomic composition similar to that of the original cell;
[0099] [0099] v) the fusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, AKT phosphorylation in response to insulin or glucose uptake (for example, labeled glucose, for example, 2- NBDG) in response to insulin, for example, at least 10% more than a negative control, for example, a similar fososome in the absence of insulin;
[00100] [00100] vi) ofusosome targets tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, peripheral nervous system , skeletal muscle, endothelium, inner ear or eye, when administered to a subject, for example, a mouse, for example, in which at least 0.1% or 10% of fusosomes in a population of administered fusosomes are present in the target tissue after 24 hours; or
[00101] [00101] the source cell is selected from a neutrophil, a granulocyte, a mesenchymal stem cell, a bone marrow stem cell, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, a myoblast , a hepatocyte or a neuron, for example, neuronal retinal cell.
[00102] [00102] The present description also provides, in some aspects, a pharmaceutical composition comprising the fososome composition described herein and a pharmaceutically acceptable carrier.
[00103] [00103] This description also provides, in certain respects, a method for administering a fusosome composition to a subject (e.g., a human subject), target tissue or cell,
[00104] [00104] This description also provides, in certain respects, a method of administering a therapeutic agent (for example, a polypeptide, a nucleic acid, a metabolite, an organelle or a subcellular structure) to a subject, a target tissue or a cell, comprising administering to the subject, or contacting the target tissue or the cell with, a plurality of fusosomes described herein, a fusosome composition comprising a plurality of fusosomes described herein, a fusosome composition described herein - prescription or a pharmaceutical composition described herein, in which the fusosome composition is administered in an amount and / or time such that the therapeutic agent is delivered.
[00105] [00105] This description also provides, in certain respects, a method for delivering a function to a subject, target tissue or cell, comprising administering to the subject or bringing the target tissue or cell into contact with a plurality of fusosomes described herein, a fusosome composition comprising a plurality of fusosomes described herein, a fusosome composition described herein or a pharmaceutical composition described herein, wherein the fusosome composition is administered in an amount and / or time such that the function is delivered.
[00106] [00106] This description also provides, in certain respects, a method of targeting a function to a subject, target tissue or cell, comprising administering to the subject or target tissue or cell in contact with a plurality of fusosomes here description
[00107] [00107] This description also provides, in certain aspects, a method of modulating, for example, enhancing, a biological function in a subject, a target tissue or a cell, comprising administering to the subject or entering to place the target tissue or the cell in contact with, a fusosome composition comprising a plurality of fusosomes described herein, a fusosome composition described herein or a pharmaceutical composition described herein, thus modulating the biological function in the subject.
[00108] [00108] This description also provides, in certain respects, a method of delivering or targeting a function to a subject, comprising administering to the subject a fusosome composition comprising a plurality of fusosomes described herein comprising the function, a fusosome composition described herein or a pharmaceutical product composition described herein, wherein the fusosome composition is administered in an amount and / or time such that the function in the subject is delivered or directed. In terms of modalities, the subject has cancer, an inflammatory disorder, autoimmune disease, a chronic disease, inflammation, damaged organ function, an infectious disease, a degenerative disorder, a genetic disease or an injury.
[00109] [00109] The description also provides, in some aspects, a method of manufacturing a fusosome composition that comprises: a) providing a source cell that comprises, for example, expressing a fusogen;
[00110] [00110] In the modalities, one or more of the following is present:
[00111] [00111] i) cell of origin is different from a 293 cell, HEK cell, human endothelial cell or human epithelial cell;
[00112] [00112] ii) fusogen is not a viral protein;
[00113] [00113] li) the fusosome, or a composition or preparation comprising a plurality of fusosomes, has a different density of 1.08 g / ml and 1.12 g / ml, for example,
[00114] [00114] iv) the fusosome has a density of 1.25 g / ml +/- 0.05, for example, measured by an Example 33 test;
[00115] [00115] v) ofusosome is not captured by the circulating scavenging system or by Kupffer cells in the liver;
[00116] [00116] vi) the fusosome is not captured by the reticuloendothelial system (RES) in a subject, for example, by an Example 76 test;
[00117] [00117] vii) when a plurality of fusosomes is administered to a subject, less than 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80% or 90% of the plurality are or are not captured by the RES after 24, 48 or 72 hours, for example, by an Example 76 test;
[00118] [00118] viii) the fusosome has a diameter greater than 5 µm, 6 µm, 7 µm, 8 µm, 10 µm, 20 µm, 50 µm, 100 µm, 150 µm or 200 µm;
[00119] [00119] ix) ofusosome comprises a cytobiological;
[00120] [00120] x) ofusosome comprises an enucleated cell; or
[00121] [00121] xi) fusosome comprises an inactivated nucleus.
[00122] [00122] In some respects, the present description provides a method
[00123] [00123] In some respects, the present description provides a method of manufacturing a fusosome composition which comprises: a) providing, for example, producing, a plurality of fososomes described herein or a composition of fusosomes here described; and b) testing one or more fusosomes of the plurality to determine whether one or more (for example, 2, 3 or more) standards are met. In the modalities, the pattern (the patterns) are chosen from:
[00124] [00124] i) ofusosome fuses at a higher rate with a target cell than with a non-target cell, for example, at least 1%, 2%, 3%, 4%, 5%, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times or 100 times, for example, in an Example 54 trial;
[00125] [00125] ii) the fusosome fuses at a higher rate with a target cell than with other fusosomes, for example, at least 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%, for example, in an example 54 trial;
[00126] [00126] iji) the fusosome fuses with the target cells at a rate such that an agent in the fusosome is delivered at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of target cells after 24, 48 or 72 hours, for example, in an Example 54 assay;
[00127] [00127] iv) the fusogen is present in a copy number of at least, or not more than, 10, 50, 100, 500, 1,000, 2,000, 5,000,
[00128] [00128] v) ofusosome comprises a therapeutic agent with a copy number of at least, or not more than 10, 50, 100, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000,
[00129] [00129] vi) the ratio between the number of copies of the fusogen and the number of copies of the therapeutic agent is between 1,000,000: 1,
[00130] [00130] vii) the fusosome comprises a lipid composition substantially similar to that of the original cell or in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA, PC, PE , PG, PI, PS, CE, SM and TAG are within 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or 75% of the corresponding lipid level in the source cell;
[00131] [00131] viii) the fusosome comprises a proteomic composition similar to that of the source cell, for example, using an Example 42 or 155 assay;
[00132] [00132] ix) the fusosome comprises a lipid to protein ratio that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, as measured using an Example assay 49;
[00133] [00133] x) ofusosome comprises a protein to nucleic acid ratio (eg DNA) which is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, as measured using an Example 50 assay;
[00134] [00134] xi) the fusosome comprises a lipid to nucleic acid ratio (for example, DNA) which is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, measured using an Example 51 or 159 assay;
[00135] [00135] xii) ofusossoma has half-life in a subject, for example, in a mouse, within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% of the half-life of a reference cell, for example, the source cell, for example, by an Example 75 test;
[00136] [00136] xiii) the fusosome carries glucose (for example, labeled glucose, for example, 2-NBDG) across a membrane, for example, at least 1%, 2%, 3%, 4%, 5%, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% more than a negative control, for example, a similar fusosome in the absence of glucose, for example example, as measured using an Example 64 assay;
[00137] [00137] xiv) the fusosome comprises esterase activity in the lumen that is within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90% or 100% of the esterase activity in a reference cell, for example, the parent cell or a mouse embryonic fibroblast, for example, using an Example 66 assay;
[00138] [00138] xv) ofusosome comprises a level of metabolic activity within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%,
[00139] [00139] xvi) ofusossoma comprises a level of respiration (for example, rate of oxygen consumption) within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the respiration level in a reference cell, for example, the source cell, for example, as described in Example 69;
[00140] [00140] xvii) the fusosome comprises an Annexin-V staining level of a maximum of 18,000, 17,000, 16,000, 15,000, 14,000,
[00141] [00141] - xvili) the fusosome has a level of miRNA content of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80%, 90% or greater than that of the source cell, for example, by an Example 39 assay;
[00142] [00142] xix) the fusosome has a soluble protein ratio: not soluble within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80%, 90% or greater than that of the original cell, for example, within 1% to 2%, 2% to 3%, 3% to 4%, 4% to 5%, 5 % to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80% or 80% to 90% of the source cell, for example, by an Example 47 assay;
[00143] [00143] xx) the fusosome has an LPS level less than 5%, 1%, 0.5%, 0.01%, 0.005%, 0.0001%, 0.00001% or less of the cell's LPS content the origin or lipid content of the fusosomes, for example, measured by mass spectrometry, for example, in an Example 48 test;
[00144] [00144] xx) the fusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, AKT phosphorylation in response to insulin or glucose uptake (for example, marked glucose, for example, 2- NBDG) in response to insulin, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 290%, 100% more than a negative control, for example, an otherwise similar fusosome in the absence of insulin, for example, using an Example 63 assay;
[00145] [00145] xxii) the fusosome has a level of justacrine signaling of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 90% or 100% higher than the level of justotácrine signaling induced by a reference cell, for example, the source cell or a bone marrow stromal cell (BMSC), for example, by an Example test 71;
[00146] [00146] xoxili) the fusosome has a paracrine signaling level of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% higher than the level of paracrine signaling induced by a reference cell, for example, the source cell or a macrophage, for example, by an Example 72 test;
[00147] [00147] xxiv) the fusosome polymerizes the actin at a level of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to the level of polymerized actin in a reference cell, for example, the parent cell or a C2C12 cell, for example, by the Example 73 test;
[00148] [00148] xxv) the fusosome has a membrane potential between about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 90%, 100% of the membrane potential of a reference cell, for example, the source cell or a C2C12 cell, for example, by an Example 74 test, or where the fusosome has a potential for membrane of about -20 to -150mV, -20 to - SOmV, - 50 to -100mV or -100 to -150mV;
[00149] [00149] xxvi) the fusosome is capable of secreting a protein, for example, at a rate of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% larger than a reference cell, for example, an embryonic mouse fibroblast, for example, using an Example 62 assay; or
[00150] [00150] xxvii) the fusosome has low immunogenicity, for example, as described herein; and
[00151] [00151] c) (optionally) approve the plurality of fusosomes or composition of fusosomes for release if one or more of the standards are met.
[00152] [00152] The present description also provides, in some respects, a method of making a fusosome composition comprising: a) providing, for example, producing, a plurality of fusosomes described herein or a composition of fusosomes described herein; and b) testing one or more fusosomes of the plurality to determine the presence or level of one or more of the following factors:
[00153] [00153] i) an immunogenic molecule, for example, an immunogenic protein, for example, as described herein;
[00154] [00154] ii) a pathogen, for example, a bacterium or virus; or
[00155] [00155] li) a contaminant; and
[00156] [00156] c) (optionally) approve the plurality of fusosomes or fusosome composition for release if one or more of the factors is below a reference value.
[00157] [00157] The present description also provides, in some aspects, a method for administering a fusosome composition to a human subject comprising: a) administering to the subject a first fusogen, under conditions that allow the disposition of the first fusogen in one or more target cells in the subject, in which one or more of: i) administering the first fusogen comprises administering a nucleic acid that encodes the first fusogen, under conditions that allow the expression of the first fusogen in one or more target cells, or ii) the first fusogen does not comprise a spiral motif, and b) administering to the human subject a composition of fusosomes comprising a plurality of fusosomes comprising a second fusogen, in which the second fusogen is with - compatible with the first fusogen, thus administering the fusosome composition to the subject.
[00158] [00158] The present description also provides, in some aspects, a method of delivering a therapeutic agent to a subject comprising: a) administering to the subject a first fusogen, under conditions that allow the disposition of the first fusogen in one or more target cells in the subject, in which one or more of: i) administering the first fusogen comprises administering a nucleic acid encoding the first fusogen, under conditions that allow the expression of the first fusogen in one or more target cells, or ii) the first fusogen does not comprise a spiral motif, and b) administering to the human subject a composition of fossosomes comprising a plurality of fusosomes comprising a second fusogen and a therapeutic agent, in which the second fusogen is compatible with the first fusogen,
[00159] [00159] thus delivering the therapeutic agent to the subject.
[00160] [00160] The present description also provides, in some aspects, a method of modulating, for example, improving, a biological function in a subject, which comprises: a) administering to the first fusogen in question, under conditions that allow the disposition of the first fusogen in one or more target cells in the subject, in which one or more of: i) administering the first fusogen comprises administering a nucleic acid that encodes the first fusogen, under conditions that allow the expression of the first fusogen in one or more target cells, or ii) the first fusogen does not comprise a spiral motif, and b) administering to the human subject a composition of fossosomes comprising a plurality of fusosomes comprising a second fusogen, in which the the second fusogen is compatible with the first fusogen, thus modulating the biological function in the subject.
[00161] [00161] In one aspect, the invention includes a fusosome comprising a chondrosome and a fusogen.
[00162] [00162] In one aspect, the invention includes a composition comprising a plurality of fusosomes, wherein at least one fusosome comprises a chondrosome and a fusogen.
[00163] [00163] The present description also provides, in some respects, a method for assessing the fusosome content of a target cell (eg fusosome fusion with a target cell) in a subject
[00164] [00164] In some respects, the present description provides a method for evaluating the fusosome content of a target cell (e.g., fusosome fusion with a target cell) in a subject, which comprises providing a sample of a subject who received a fusosome composition, for example, as described here and testing the biological sample for the presence of a fumogen, for example, a fusogen described here. In some cases, the level of fusogen detected is higher (for example, at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100 %, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 2000%, 3000%, 4000%, 5000%, 10,000%, 50,000% or 100,000% higher ) than that observed in a corresponding biological sample from a subject who did not receive a fusosome composition. In some modalities, the subject is the same subject before the administration of the fusosome composition and, in some modalities, the subject is a different subject.
[00165] [00165] In some respects, the present description provides a method for assessing the fusosome content of a target cell (for example, fusosome fusion with a target cell) in a subject, which comprises providing a sample biological from a subject who received a fusosome composition, for example, as described herein and testing the biological sample for the presence of a charge or payload, for example, delivered by a fusosome as described here. In some cases, the level of charge or charge detected is higher (for example, at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% , 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1,000%, 2,000%, 3,000%, 4,000%, 5,000%,
[00166] [00166] In some respects, the present description provides a method for evaluating the fusosomal content of a target cell (e.g., fusosome fusion with a target cell in a subject), which comprises providing a biological sample from a subject who received a fusosome composition, for example, as described here and testing the biological sample for alteration of an activity related to the fusosome composition, for example, an activity related to a charge or payload delivered by the composition of fososome. In some cases, the level of detected activity is increased, for example, by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 %, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1,000%, 2,000%, 3,000%, 4,000%, 5,000%,
[00167] [00167] In one aspect, the present description provides a method for evaluating fusion of the fusosome to a target cell in a subject, which comprises providing a biological sample from a subject who has received a composition of the fusosome, for example, as described described here, and assess a level of unfused fusosomes in the biological sample.
[00168] [00168] Any of the aspects mentioned here, for example, fusosomes, fusosome compositions and methods above, can be combined with one or more of the modalities described here, for example, one modality below.
[00169] [00169] In some embodiments, the fusosome is capable of delivering (for example, delivery) an agent, for example, a protein, nucleic acid (for example, mRNA), organelle or metabolite in the cytosol of a target cell. Likewise, in some modalities, a method here comprises delivering an agent to the cytosol of a target cell. In some embodiments, the agent is a protein (or a nucleic acid that encodes the protein, for example, an mRNA that encodes the protein) that is absent, mutant, or at a lower level than the wild type in the target cell. In some modalities, the target cell is that of a subject with a genetic disease, for example, a monogenic disease, for example, a monogenic intracellular protein disease. In some modalities, the agent understands a transcription factor, for example, an exogenous transcription factor or an endogenous transcription factor. In some modalities, the fusosome further comprises, or the method further comprises, the delivery of one or more (for example, at least 2, 3, 4, 5, 10, 20 or 50) additional transcription factors, for example, exogenous transcription factors, endogenous transcription factors or a combination thereof.
[00170] [00170] In some embodiments, the fusosome comprises (for example, it is capable of delivering to the target cell) a plurality of agents (for example, at least 2, 3, 4, 5, 10, 20 or 50 agents), where each agent of the plurality acts in a one-step pathway in the target cell, for example, where the pathway is a biosynthetic pathway, a catabolic pathway or a signal transduction cascade. In the modalities, each agent in the plurality regulates the route or regulates the downward route. In some embodiments, the fusosome further comprises, or the method further comprises the delivery of, an additional additional agent (for example, it comprises a second plurality of agents) that do not act in a stage of the path, for example, that act in a stage of a second way. In some modalities, the fusosome comprises (for example, it is capable of delivering to the target cell) or the method further comprises the delivery of a plurality of agents (for example, at least 2, 3, 4, 5, 10 , 20 or 50 agents), where each agent of the plurality is part of a single pathway, for example, where the pathway is a biosynthetic pathway, a catholic pathway or a signal transduction cascade. In some modalities, the fusosome further comprises, or the method further comprises, the delivery of an additional additional agent (for example, comprises a second plurality of agents) that are not part of the single pathway, for example, are part of a duplicate.
[00171] [00171] In some embodiments, the target cell comprises an aggregated or folded protein. In some modalities, the fusosomal
[00172] [00172] In some embodiments, the agent is selected from a transcription factor, an enzyme (for example, nuclear enzyme or cytosolic enzyme), a reagent that mediates a specific DNA sequence modification (for example, Cas9, ZFN or TALEN ), mRNA (for example, encoding MRNA an intracellular protein), organism or metabolite.
[00173] [00173] In some embodiments, the fusosome is capable of delivering (for example, delivery) an agent, for example, a protein, to the cell membrane of a target cell. Likewise, in some embodiments, a method here comprises delivering an agent to the cell membrane of a target cell. In some embodiments, delivering the protein comprises delivering a nucleic acid (for example, MRNA) that encodes the protein to the target cell, so that the target cell produces the protein and localizes it on the membrane. In some embodiments, the fusosome comprises, or the method further comprises delivering the protein and fusing the fusosome with the target cell transfers the protein to the cell membrane of the target cell. In some embodiments, the agent comprises a cell surface ligand or an antibody that binds a cell surface receptor. In some embodiments, the fusosome further comprises, or the method further comprises delivering, a second agent comprising or encoding a second cell surface ligand or antibody that binds a cell surface receptor and, optionally, further comprising or encoding one or more additional cell surface ligands or antibodies that bind to a cell surface receptor (for example, 1, 2, 3, 4, 5, 10, 20, 50 or more). In some modalities
[00174] [00174] In some embodiments, the first agent and the second agent form a complex, in which optionally the complex further comprises one or more additional receptors on the cell surface. In some embodiments, the agent comprises or encodes an antigen or protein that has an antigen.
[00175] [00175] In some embodiments, the fusosome is capable of delivering (for example, delivery) a secreted agent, for example, a secreted protein to a destination site (for example, an extracellular region), for example, delivering a nucleic acid (for example, MRNA) that encodes the protein for the target cell under conditions that allow the target cell to produce and secrete the protein. Likewise, in some embodiments, a method here comprises delivering a secret agent as described here. In modalities, the secreted protein is endogenous or exogenous. In the embodiments, the secreted protein comprises a therapeutic protein, for example, an antibody molecule, a cytokine or an enzyme. In embodiments, the secreted protein comprises an autocrine signaling molecule or a paracrine signaling molecule. In the embodiments, the secreted agent comprises a secretory granule.
[00176] [00176] In some embodiments, the fusosome is able to reprogram (for example, reprogram) a target cell (for example, an immune cell), for example, delivering an agent selected from a transcription factor or mMRNA , or a plurality of said agents. Likewise, in some embodiments, a method here comprises reprogramming a target cell. In modalities, reprogramming involves inducing a pancreatic endocrine cell to assume one or more characteristics of a pancreatic beta cell, inducing a non-dopaminergic neuron to assume one or more characteristics of a dopaminergic neuron or inducing a depleted T cell to assume one or more characteristics of an unexhausted T cell, for example, a killer T cell. In some embodiments, the agent comprises an antigen. In some embodiments, the fusosome comprises a first agent comprising an antigen and a second agent comprising an antigen which has protein.
[00177] [00177] In some embodiments, the fusosome is able to donate (for example, donate) one or more cell surface receptors to a target cell (for example, an immune cell). Likewise, in some embodiments, a method here comprises donating one or more cell surface receptors.
[00178] [00178] In some embodiments, a fusosome is capable of modifying, for example, modifying a target tumor cell. Likewise, in some embodiments, a method here comprises modifying a target tumor cell. In modalities, the fusosome comprises an MRNA that encodes an immunostimulatory ligand, a protein that has antigen, a tumor suppressor protein or a pro-apoptotic protein. In some embodiments, the fusosome comprises a miRNA capable of reducing levels in a target cell of an immunosuppressive ligand, a mitogenic signal or a growth factor.
[00179] [00179] In some embodiments, a fusosome comprises an agent that is immunomodulatory, for example, immunostimulatory.
[00180] [00180] In some modalities, a fusosome is able to cause (for example, causes) the target cell to present an antigen. Likewise, in some modalities, a method here comprises presenting an antigen in a target cell.
[00181] [00181] In some modalities, the fusosome promotes regeneration in a target tissue. Likewise, in some modalities, a method here comprises promoting regeneration in a target tissue. In embodiments, the target cell is a cardiac cell, for example, a cardiomyocyte (for example, a quiescent cardiomyocyte), a hepatoblast (for example, a bile duct hepatoblast), an epithelial cell, a T cell virgin, a macrophage (for example, an infiltrating macrophage tumor) or a fibroblast (for example, a cardiac fibroblast). In the embodiments, the source cell is a T cell (for example, a Treg), a macrophage or a cardiac myocyte.
[00182] [00182] In some embodiments, the fusosome is capable of delivering (for example, delivery) a nucleic acid to a target cell, for example, stably modifying the genome of the target cell, for example, for gene therapy . Likewise, in some modalities, a method here comprises delivering a nucleic acid to a target cell. In some embodiments, the target cell has an enzyme deficiency, for example, it comprises a mutation in an enzyme leading to reduced activity (for example, no activity) of the enzyme.
[00183] [00183] In some embodiments, the fusosome is able to deliver (for example, delivery) a reagent that mediates a specific DNA sequence change (for example, Cas9, ZFN or TALEN) in the target cell. Likewise, in some modalities, a method
[00184] [00184] In some embodiments, the fusosome is capable of delivering (for example, delivery) a nucleic acid to a target cell, for example, transiently modifying gene expression in the target cell.
[00185] [00185] In some modalities, the fusosome is able to deliver (for example, delivery) a protein to a target cell, for example, to temporarily rescue a protein deficiency. Likewise, in some modalities, a method here comprises delivering a protein to a target cell. In the embodiments, the protein is a membrane protein (for example, a membrane-carrying protein), a cytoplasmic protein (for example, an enzyme) or a secreted protein (for example, an immunosuppressive protein).
[00186] [00186] In some modalities, the fusosome is able to deliver (for example, delivery) an organelle to a target cell, for example, in which the target cell has a defective organelle network. Likewise, in some modalities, a method here involves delivering an organelle to a target cell. In the modalities, the cell of origin is a hepatocyte, a skeletal muscle cell or a neuron.
[00187] [00187] In some embodiments, the fusosome is capable of delivering (for example, delivery) a nucleus to a target cell, for example, in which the target cell has a genetic mutation. Likewise, in some embodiments, a method here comprises delivering a nucleus to a target cell. In some embodiments, the nucleus is autonomous and comprises one or more genetic changes in relation to the target cell, for example, it comprises a specific modification of the sequence in the DNA (for example, Cas9, ZFN or TALEN) or a cro-
[00188] [00188] In some embodiments, the fusosome is capable of intracellular molecular delivery, for example, delivering a protein agent to a target cell. Likewise, in some embodiments, a method here comprises delivering a molecule to an intracellular region of a target cell. In the embodiments, the protein agent is an inhibitor. In the embodiments, the protein agent comprises a nanobody, scFv, camelid antibody, peptide, macrocycle or small molecule.
[00189] [00189] In some embodiments, the fusosome is capable of causing (for example, causes) a target cell to secrete a protein, for example, a therapeutic protein. Likewise, in some embodiments, a method here involves getting a target cell to secrete a protein.
[00190] [00190] In some embodiments, the fusosome is capable of secreting (for example, secreting) an agent, for example, a protein. In some modalities, the agent, for example, secret agent, is delivered to a destination in a subject. In some modalities, the agent is a protein that cannot be produced recombinantly or is difficult to be produced recombinantly. In some embodiments, the fusosome that secretes a protein is from a cell of origin selected from an MSC or a chondrocyte.
[00191] [00191] In some embodiments, the fusosome comprises in its membrane one or more cell surface ligands (for example, 1, 2, 3, 4, 5, 10, 20, 50 or more cell surface ligands). Likewise, in some embodiments, a method here comprises presenting one or more cell surface ligands to a target cell. In some embodiments, the fusosome with a cell surface ligand is from a cell of origin chosen from a neutrophil (for example, and the target cell is a tumor-infiltrating lymphocyte), a dendritic cell (for example , and the target cell is a virgin T cell), or neutrophil (for example, and the target is a tumor cell or virus-infected cell). In some embodiments, the fusosome comprises a membrane complex, for example, a complex comprising at least 2, 3, 4 or 5 proteins, for example, a homodimer, heterodimer, homotrimer, heterotrimer, homotetramer or heterotetramer. In some embodiments, the fusosome comprises an antibody, for example, a toxic antibody, for example, the fusosome is capable of delivering the antibody to the target site, for example, returning to the target site. In some modalities, the source cell is an NK or neutrophil cell.
[00192] [00192] In some embodiments, a method here comprises causing secretion of a protein from a target cell or presentation of ligand on the surface of a target cell. In some embodiments, the fusosome is capable of causing cell death of the target cell. In some embodiments, the fusosome is from an NK cell.
[00193] [00193] In some embodiments, a fusosome or target cell is capable of phagocytosis (for example, of a pathogen). Likewise, in some modalities, a method here comprises causing phagocytosis.
[00194] [00194] In some modalities, a fusosome detects and responds to its local environment. In some embodiments, the fusosome is able to detect the level of a metabolite, interleukin or antigen.
[00195] [00195] In modalities, a fusosome is capable of chemotaxis,
[00196] [00196] In some embodiments, the fusosome comprises (for example, it is capable of delivering to the target cell) a plurality of agents (for example, at least 2, 3, 4, 5, 10, 20 or 50 agents). In the embodiments, the fusosome comprises an inhibitory nucleic acid (for example, siRNA or miRNA) and an mRNA.
[00197] [00197] In some embodiments, the fusosome comprises (for example, it is capable of delivering to the target cell) a membrane protein or a nucleic acid that encodes the membrane protein. In embodiments, the fusosome is capable of reprogramming or transdifferentiating a target cell, for example, the fusosome comprises one or more agents that induce reprogramming or transdifferentiation of a target cell.
[00198] [00198] In some modalities, the subject needs regeneration. In some modalities, the subject suffers from cancer, an autoimmune disease, an infectious disease, a metabolic disease, a neurodegenerative disease or a genetic disease (for example, enzyme deficiency).
[00199] [00199] In some modalities (for example, modalities for testing non-endocytic cargo delivery), cargo delivery is tested using one or more of (for example, all) the following steps: (a) place 30,000 cells target HEK-293T in a first well of a 96-well titration plate comprising 100 nM bafilomycin A1 and place a similar number of similar cells in a second well of a 96-well titration plate without bafilomycin A1, (b) culturing the target cells for four hours in DMEM medium at 37ºC and 5% CO ;, (c) putting the target cells in contact with 10 µg of charge-containing fusosomes, (d) incubating the target cells target and fusosomes for 24 hours at 37ºC and 5% CO: ,, and (e) determine the percentage of cells in the first well and the second well that makes up the load. Step (e) may comprise detecting the charge using microscopy, for example, using immunofluorescence. Step (e) may comprise detecting the charge indirectly, for example, detecting an effect downstream of the charge, for example, the presence of a reporter protein. In some embodiments, one or more of steps (a) to (e) above are performed as described in Example
[00200] [00200] In some embodiments, an endocytosis inhibitor (for example, chloroquine or bafilomycin A1) inhibits endosomal acidification. In some modalities, cargo delivery is independent of lysosomal acidification. In some embodiments, an endocytosis inhibitor (eg, Dynasore) inhibits dinamine. In some modalities, cargo delivery is independent of the activity of dynamin.
[00201] [00201] In some modalities (for example, specific cargo delivery modalities to a target cell versus a non-target cell), cargo delivery is tested using one or more of (for example, all) the following steps: ( a) place 30,000 HEK-293T target cells that overexpress CD8a and CD8b in a first well of a 96-well titration plate and place 30,000 non-target HEK-293T cells that do not overexpress CD8a and CD8b in a second well of a plate 96-well titration, (b) culturing cells during
[00202] [00202] In some ways:
[00203] [00203] ii) the source cell is different from a 293 cell, HEK cell, human endothelial cell or human epithelial cell;
[00204] [00204] iii) fusogen is not a viral protein;
[00205] [00205] iv) the fusosome, or a composition or preparation comprising a plurality of fusosomes, has a different density of 1.08 g / ml and 1.12 g / ml, for example,
[00206] [00206] v) the fusosome has a density of 1.25 g / ml +/- 0.05, for example, measured by an Example 33 test;
[00207] [00207] vi) the ofusosome is not captured by the circulating sequestering system or by the Kupffer cells in the liver;
[00208] [00208] vii) the fusosome is not captured by the reticuloendothelial system (RES) in a subject, for example, by an Example 76 test;
[00209] [00209] viii) when a plurality of fusosomes is administered to a subject, less than 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80% or 90% of the plurality are captured by the RES after 24, 48 or 72 hours, for example, by an Example 76 test;
[00210] [00210] ix) the fusosome has a diameter greater than 5 µm, 6 µm, 7 µm, 8 µm, 10 µm, 20 µm, 50 µm, 100 µm, 150 µm or 200 µm.
[00211] [00211] In some embodiments, the fusosome comprises or is composed of a cytobiological. In some embodiments, the fusosome comprises an enucleated cell. In some embodiments, the fusosome comprises an inactivated nucleus. In some modalities, the fusosome does not comprise a functional nucleus.
[00212] [00212] In some embodiments, the fusosome or fusosome composition has or is identified as having one or more of (for example, at least 2, 3, 4 or 5) of the properties contained herein, for example, the properties below.
[00213] [00213] In some embodiments, the fusosome fuses at a higher rate with a target cell than with a non-target cell, for example, at least 1%, 2%, 3%, 4%, 5 %, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, or 100 times, for example, in an Example 54 assay In some embodiments, the spindle-melt fuses at a higher rate with a target cell than with other fusosomes, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%, for example, in an Example 54 trial. In some modalities, the fusosome fuses with the target cells at a rate such that an agent in the fusosome is delivered to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of cells target after 24, 48 or 72 hours, for example, in an Example 54 trial. In the embodiments, the amount of targeted fusion is about 30% to 70%, 35% to 65%, 40% to 60%, 45% to 55% or 45% to 50%, for example, about 48.8%, p for example, in an Example 54 trial. In the modalities, the amount of targeted fusion is about 20% to 40%, 25% to 35% or 30% to 35%, for example, about 32.2 %, for example, in an Example 55 trial.
[00214] [00214] In some embodiments, fusogen is present in a copy number of at least, or no more than 10, 50, 100, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000,
[00215] [00215] In some embodiments, the fusosome comprises a therapeutic agent with a number of copies of at least, or no more than 10, 50, 100, 500, 1,000, 2,000, 5,000, 10,000, 20,000,
[00216] [00216] In some embodiments, the fusosome delivers to a target cell at least 10, 50, 100, 500, 1,000, 2,000, 5,000, 10,000,
[00217] [00217] In some embodiments, the fusosome delivers to a target cell at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the charge (for example, a therapeutic agent, for example, an endogenous therapeutic agent or an exogenous therapeutic agent) comprised by the fusosome. In some embodiments, fusosomes that fuse with the target cell (or target cells) deliver to the target cell an average of at least
[00218] [00218] In some embodiments, the fusosome comprises 0.00000001 mg of fusogen to 1 mg of fusogen per mg of total protein in fusosome, for example, 0.00000001 to 0.0000001, 0.0000001 to 0.000001, 0, 000001 to 0.00001, 0.00001 to 0.0001, 0.0001 to 0.001, 0.001 to 0.01, 0.01 to 0.1 or 0.1 to 1 mg of fusogen per mg of total protein in the fusosome. In some embodiments, the fusosome comprises 0.00000001 mg of fusogen to 5 mg of fusogen per mg of lipid in the fusosome, for example, 0.00000001 to 0.0000001, 0.0000001 to 0.000001, 0.000001 to 0.00001, 0.00001 to 0.0001, 0.0001 to 0.001, 0.001 to 0.01, 0.01 to 0.1, 0.1 to 1 or 1 to 5 mg of fusogen per mg of lipid in the fusosome .
[00219] [00219] In some modalities, the load is a protein load. In modalities, the charge is an endogenous or synthetic protein charge. In some embodiments, fusosomes have (or are identified as having) at least 1, 2, 3, 4, 5, 10, 20, 50, 100, or more protein charge molecules per fusosome. In one embodiment, fossosomes have (or are identified as having) about 100, 110, 120, 130, 140, 150, 160, 166, 170, 180, 190 or 200 fusosome protein agent molecules, for example for example, quantified according to the method described in Example 156. In some
[00220] [00220] In some embodiments, the fusogen comprises (or is identified as comprising) at least 0.5%, 1%, 5%, 10% or more of the total protein in a fusosome, for example, by a spectrometry assay of pasta. In one embodiment, fusogen comprises (or is identified as comprising) about 1 to 30%, 5 to 20%, 10 to 15%, 12 to 15%, 13 to 14% or 13.6% of the total protein in a fusosome, for example, by a mass spectrometry assay. In some embodiments, fusogen is more abundant than other proteins of interest. In embodiments, fusogen has (or is identified as having) a reason for a payload protein, for example, EGFP, from about 145 to 170, 150 to 165, 155 to 160, 156.9, for example, a mass spectrometry test. In modalities, fusogen has (or is identified as having) a reason for CD63 of about 1,000 to 5,000, 2,000 to 4,000, 2,500 to
[00221] [00221] In some modalities, the number of lipid species present in both (for example, shared between) the fusosomes and the cells of origin is (or is identified as being) at least 300, 400, 500, 550 , 560 or 569, or is between 500 to 700, 550 to 600 or 560 to 580, for example, using a mass spectrometry assay. In modalities, the number of lipid species present in fusosomes at a level of at least 25% of the corresponding lipid level in the source cells (both normalized to total lipid levels within a sample) is (or is identified as being ) at least 300, 400, 500, 530, 540 or 548, or is between 400 to 700, 500 to 600, 520 to 570, 530 to 560 or 540 to 550, for example,
[00222] [00222] In some modalities, the number of protein species present in (for example, shared among) fusosomes are cells of origin is (or is identified as being) at least 500, 1,000, 1,100, 1,200, 1,300, 1,400, 1,487, 1,500, or 1,600, or is (or is identified as being) between 1,200 to 1,700, 1,300 to 1,600,
[00223] [00223] In some modalities, CD63 is (or is identified as being) present in less than 0.048%, 0.05%, 0.1%, 0.5%,
[00224] [00224] In some embodiments, fusosomes are produced by extrusion through a filter, for example, a filter of about 1 to 10.2a8.3a7.4a60or5 um. In some embodiments, spindles have (or are identified as having) an average diameter of about 1a 5.2a5.3a5.4a5or5 um. In some embodiments, fusosomes have (or are identified as having) an average diameter of at least 1, 2, 3, 4 or 5 µm.
[00225] [00225] In some embodiments, fusosomes are enriched for (or are identified as being enriched for) one or more of (for example, at least 2, 3, 4, 5 or all) the following lipids compared to cells of origin: cholesteryl ester, free cholesterol, ether-linked smooth-phosphatidylethanolamine, ether-linked smooth-phosphatidylserine, phosphatidylethanolamine, phosphatidylserine and sphingomyelin. In some embodiments, fusosomes are depleted for (or identified as depleted for) one or more of (for example, at least 2, 3, 4, 5 or all) the following lipids compared to the source cells: ceramide, cardiolipin, smooth-phosphatidylcholine, smooth-phosphatidylethanolamine, smooth-phosphatidylglycerol, smooth-phosphatidylinositol, ether-linked phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol and triac. In some embodiments, fusosomes are enriched for (or are identified as being enriched for) one or more of the enriched lipids mentioned above and depleted for one or more of the depleted lipids mentioned above. In some embodiments, fusosomes comprise (or are identified as comprising) the enriched lipid as a percentage of the total lipid that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 5 times or 10 times higher than the corresponding level in the source cells. In some embodiments, the fusosome comprises (or is identified as comprising) depleted lipid as a percentage of total lipid below 90%, 80%, 70%, 60%, 50%, 40%, 30% , 20% or 10% of the corresponding level in the source cells. In modalities, lipid enrichment is measured by a mass spectrometry assay, for example, an Example 164 assay.
[00226] [00226] In some embodiments, the lipid levels of EC are (or are identified as being) about 2 times higher in spindles than in exosomes and / or about 5, 6, 7, 8, 9 or 10 times more in fusosomes than in parental cells (in relation to the | total apid in a sample). In some embodiments, the levels of ceramide lipids are (or are identified as being) about 2, 3, 4 or 5 times higher in parental cells than in fusosomes (relative to the total lipid in a sample). In some modalities, cholesterol levels are (or are identified as) about 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1, 8, 1.9 or 2 times higher in exosomes than in fusosomes and / or about 2 times higher in fusosomes than in parental cells (in relation to the total lipid in a sample). In some embodiments, the lipid levels of CL are (or are identified as being) at least about 5, 10, 20, or 40 times higher in parental cells than in fusosomes (relative to the total lipid in a sample). In some modalities, the lipid levels of DAG are (or are identified as being) about 2 or 3 times higher in exosomes than in fusosomes and / or about 1.5 or 2 times more in parental cells than in fusosomes (relative to the total lipid in a sample). In some modalities, PC lipid levels are (or are identified as being) approximately equal between exosomes and fusosomes and / or about 1.3, 1.4, 1.5, 1.6, 1.7 or 1.8 times more in cells
[00227] [00227] In some embodiments, fusosomes are (or are identified as being) enriched by one or more of (for example, at least 2, 3, 4, 5 or all) the following lipids compared to exosomes: cholesteryl ester, ceramide, diacylglycerol, smooth phosphatidate and phosphatidylethanolamine and triacylglycerol. In some embodiments, fusosomes are (or are identified as being) depleted for one or more of (for example, at least 2, 3, 4, or all) the following lipids compared to exosomes (relative to the total lipid in a sample): cholesterol! free, hexosil ceramide, smooth phosphatidylcholine, smooth phosphatidylcholine bound to ether, smooth phosphatidylethanolamine, smooth phosphatidylethanolamine bound to ether and smooth phosphatidylserine. In some embodiments, fusosomes are (or are identified as being) enriched for one or more of the aforementioned enriched lipids and depleted for one or more of the aforementioned depleted lipids. In some embodiments, fusosomes comprise (or are identified as comprising) enriched lipid as a percentage of total lipid that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 5 times or 10 times higher than the corresponding level in exosomes. In some embodiments, the fusosome comprises (or is identified as comprising) depleted lipid as a percentage of total lipid at a level below 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20 % or 10% of the corresponding level in the exosomes. In the embodiments, lipid enrichment is measured by a mass spectrometry assay, for example, an Example 164 assay.
[00228] [00228] In some embodiments, ceramide lipid levels are (or are identified as being) about 2 times higher in fusosomes than in exosomes and / or about 2 times higher in parental cells than in fusosomes ( in relation to | total lipid in a sample). In some modalities, the lipid levels of HexCer are (or are identified as being) about 1.5, 1.6, 1.7, 1.8, 1.9 or 2 times higher in exosomes than in fososomes and / or almost equal in parental cells and fusosomes (in relation to the total lipid in a sample). In some modalities, LPA lipid levels are (or are identified as being) about 3 or 4 times higher in fusosomes than in exosomes and / or 1.3, 1.4, 1.5, 1.6, 1.7 or 1.8 times more in fusosomes than in parental cells (in relation to the total lipid in a sample). In some embodiments, LPC lipid levels are (or are identified as being) about 2 times higher in exosomes than in fusosomes and / or about 1.5, 1.6, 1.7, 1.8, 1.9 or 2 times more in parental cells than in fusosomes (in relation to the | total pidid in a sample). In some embodiments, LPC O- lipid levels are (or are identified as being) about 3 or 4 times higher in exosomes than in fusosomes and / or approximately equal between parental cells and fusosomes (in re - lation to total lipid in a sample). In some embodiments, LPE O- lipid levels are (or are identified as) about 1.5, 1.6, 1.7, 1.8, 1.9 or 2 times higher in exosomes than in fusosomes and / or about 1.5, 1.6, 1.7, 1.8, 1.9, or 2 times higher in parental cells than in fusosomes (relative to the total lipid in a sample). In some embodiments, LPE O- lipid levels are (or are identified as being) about 2 or 3 times higher in exosomes than in fusosomes and / or approximately equal between parental cells and fusosomes (in relation to lipids) - total audio in a sample). In some modalities, LPS lipid levels are (or are identified as being) about 3 times higher in exosomes than in fusosomes (in relation to the | total lipid in a sample). In some embodiments, PA lipid levels are (or are identified as) about 1.5, 1.6, 1.7, 1.8, 1.9 or 2 times higher in fusosomes than in exosomes and / or about 2 times higher in fusosomes than in parent cells (relative to the total lipid in a sample). In some modalities, PG lipid levels are (or are identified as being) approximately equal between fusosomes and exosomes and / or 10, 11, 12, 13, 14 or 15 times more in parental cells than in cells. sosomes (relative to the total lipid in a sample).
[00229] [00229] In some embodiments, the fusosome comprises a lipid composition substantially similar to that of the cell of origin or in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA , PC, PE, PG, PI, PS, CE, SM and TAG are between 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of the corresponding lipid level in the cell source. In the modalities, the lipid composition of the fusosomes is similar to the cells from which they are derived. In modalities, fusosomes and parent cells have (or are identified as having) a similar lipid composition if greater than or equal to about 50%, 55%, 60%, 65%, 70%, 75%, 80% , 85%, or 90% of the lipid species identified in any replicated sample of the parental cells are present (or are identified as present) in any replicated sample of the fososomes, for example, as determined according to Example 154. In the modalities, of identified lipids, the average level in the fusosome is greater than about 10%, 15%, 20%, 25%, 30%, 35%
[00230] [00230] In some embodiments, the lipid composition of the spindle sum is (or is identified as brought) enriched and / or depleted for specific lipids in relation to the parental cell, for example, as determined according to the method described in the Example
[00231] [00231] In some embodiments, the fusosome has (or is identified as having) a ratio of phosphatidylserine to total lipids that is greater than that of the parental cell. In the modalities, the fusosome has (or is identified as having) a ratio of phosphatidylserine to total lipids of about 110%, 115%, 120%, 121%, 122%, 123%, 124%, 125%, 130 %, 135%, 140% or more in relation to the rental cell. In some embodiments, the fusosome is (or is identified as being) enriched for cholesteryl ester, free cholesterol, ether-linked smooth-phosphatidylethanolamine, ether-linked smooth-phosphatidylserine, phosphatidylethanolamine, and / or sphingomyelin in relation to the parental cell. In some embodiments, fusosomes are (or are identified as being) depleted for ceramide, cardiolipin, - smooth-phosphatidylcholine, - smooth-phosphatidylethanolamine, - smooth-phosphatidylglycerol, smooth-phosphatidylinositol, ether-linked phosphatidylcholine, phosphatidylethanolamine phosphatidylglycerol |, phosphatidylinositol and / or triacylglycerol in relation to the parental cell. In some embodiments, the fusosome is (or is identified as being) enriched in cholesterol ester, ceramides, diacylglycerol, smooth phosphatidate, phosphatidylethanolamine and / or triacylglycerol in relation to an exosome. In some embodiments, the fusosome is (or is identified as being) depleted for cholesterol!
[00232] [00232] In some embodiments, the fusosome has a cardiolipin: ceramide ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: ceramide ratio in the source cell; or it has a cardiolipin: diacylglycerol ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: diacylglycerol ratio in the source cell; or it has a cardiolipin: hexosilceramide ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: hexosilceramide ratio in the source cell; or it has a cardiolipinisisphosphatidate ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: lysophosphatidate ratio in the source cell; or it has a cardiolipin: smooth-phosphatidylcholine ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: smooth-phosphatidylcholine ratio in the source cell; or it has a cardiolipin: smooth-phosphatidylethanolamine ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: smooth-phosphatidylethanolamine ratio in the source cell; or it has a cardiolipin: smooth-phosphatidylglycerol ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: smooth-phosphatidylglycerol ratio in the source cell; or it has a cardiolipin-to-phosphatidylinositol ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: smooth-phosphatidylinositol ratio in the source cell; or it has a cardiolipin: smooth-phosphatidylserine ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: smooth-phosphatidylserine ratio in the source cell; or it has a cardiolipin: phosphatidate ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: phosphatidate ratio in the source cell; or it has a cardiolipin: phosphatidylcholine ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: phosphatidylcholine ratio in the source cell; or it has a cardiolipin: phosphatidylethanolamine ratio that is within 10%, 20% 30% 40% or 50% of the cardiolipin: phosphatidylethanolamine ratio in the source cell; or it has a cardiolipin: phosphatidylglycerol ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: phosphatidylglycerol ratio in the source cell; or it has a cardiolipin: phosphatidylinositol ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: phosphatidylinosite ratio! in the source cell; or it has a cardiolipin: phosphatidylserine ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: phosphatidylserine ratio in the source cell; or it has a cardiolipin: cholesterol ester ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: cholesterol ester ratio in the source cell; or it has a cardiolipin: sphingomyelin ratio that is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: sphingomyelin ratio in the source cell; or it has a cardiolipin reason: triacylglycerine! which is within 10%, 20%, 30%, 40% or 50% of the cardiolipin: triacylglycerol ratio in the source cell; or it has a phosphatidylcholine: ceramide ratio that is within 10%, 20%, 30%, 40% or 50% of the phosphatidylcholine: ceramide ratio in the source cell; or it has a phosphatidylcholine: diacylglycerol ratio that is within 10%, 20%, 30%, 40% or 50% of the phosphatidylcholine: diacylglycerol ratio in the source cell; or it has a phosphatidylcholine: hexosilceramide ratio that is within 10%, 20%, 30%, 40% or 50% of the phosphatidylcholine: hexosylceramide ratio in the source cell; or it has a phosphatidylcholine: lysophosphatidate ratio that is within 10%, 20%, 30%, 40% or 50% of the phosphatidylcholine: lysophosphatidate ratio in the source cell; or it has a phosphatidylcholine: smooth-phosphatidylcholine ratio that is within 10%, 20%, 30%, 40% or 50% of the phosphatidylcholine: smooth-phosphatidylcholine ratio in the source cell; or it has a phosphatidylcol-nailiso-phosphatidylethanolamine ratio that is within 10%, 20%, 30%, 40%
[00233] [00233] In some embodiments, the fusosome comprises a proteomic composition similar to that of the source cell, for example, using an Example 42 or 155 assay. In some modalities, the protein composition of fusosomes is similar to parental cells from which they are derived. In some modalities, the con-
[00234] [00234] In some embodiments, the fusosome comprises a lipid to protein ratio that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example, as measured using an Example 49 assay. In modalities, the fusosome comprises (or is identified as comprising) a lipid-to-protein mass ratio approximately equal to the lipid-to-protein mass ratio for nucleated cells. In embodiments, the fusosome comprises (or is identified as comprising) a lipid: protein ratio larger than the parental cell. In the modalities, the fusosome comprises (or is identified as comprising) a lipid: protein ratio of about 110%, 115%, 120%, 125%, 130%, 131%, 132%, 132.5%, 133%, 134%, 135%, 140%, 145% or 150% of the lipid: protein ratio of the parental cell. In some embodiments, the fusosome or fusosome composition has (or is identified as having) a phospholipid: protein ratio of about 100 to 180, 110 to 170, 120 to 160, 130 to 150, 135 to 145, 140 at 142 or 141 pmol / g, for example, in a test of Example 150. In some embodiments, the composition of fososomes or fusosomes has (or is identified as having) a phospholipid: protein ratio that is about 60 to 90%, 70 to 80% or 75% of the corresponding ratio in the source cells, for example, in an Example 150 assay.
[00235] [00235] In some embodiments, the fusosome comprises a protein to nucleic acid ratio (for example, DNA or RNA) that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the cell of origin, for example, as measured using a test from Example 50. In embodiments, the fusosome comprises (or is identified as comprising) a protein-to-DNA mass mass ratio similar to that of a parental cell. In modalities, the fusosome comprises (or is identified as
[00236] [00236] In some embodiments, the fusosome comprises a lipid to nucleic acid ratio (for example, DNA) that is within 10%, 20%, 30%, 40% or 50% of the corresponding ratio in the source cell, for example example, as measured using an Example 51 or 159 assay. In some embodiments, the fososome or fusosome composition comprises (or is identified as comprising) a lipid: DNA ratio that is about 2.0 to 6.0, 3.0 to 5.0, 3.5 to 4.5, 3.8 to 4.0 or 3.92 umol / mg, for example, by a test of Example 152. In some embodiments , the fusosome comprises a ratio of lipids to nucleic acids (for example, DNA) that is greater than the corresponding ratio in the source cell, for example, at least 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80% or 90% greater, for example, as measured using an Example 51 or 159 assay. In embodiments, the fusosome comprises (or is identified as comprising) a lipid: DNA ratio greater than the parental cell. In modalities, the fusosome comprises about 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, 150% or higher lipid: DNA ratio compared to the parental cell .
[00237] [00237] In some embodiments, the fusosome composition has a half-life in a subject, for example, in a mouse, which is within 1%, 2%, 3%, 4%, 5%, 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% of the half-life of a reference cell composition, for example, the source cell, for example, by an I leave Example 75. In some embodiments, the fossa composition has a half-life in a subject, for example, in a mouse, which is at least 1 hour, 2 hours, 3 hours, 4 hours, 5 hours , 6 hours, 12 hours or 24 hours, for example, in a human subject or in a mouse, for example, by an Example 75 assay. In embodiments, the fusosome composition has a half-life of at least 1, 2 , 4, 6, 12 or 24 hours in a subject, for example, in an Example 134 trial. In some embodiments, the therapeutic agent has a half-life in a subject that is longer than the half-life of the fusosome composition, for example, at least 10%, 20%, 50%, 2 times, 5 times, or 10 times. For example, the fusosome can deliver the therapeutic agent to the target cell and the therapeutic agent can be present after the fusosome is no longer present or detectable.
[00238] [00238] In some embodiments, the fusosome carries glucose (for example, labeled glucose, for example, 2-NBDG) across a membrane, for example, at least 1%, 2%, 3%, 4%, 5% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% more than a negative control, for example, a similar fusosome in the absence of glucose , for example, as measured using a
[00239] [00239] In some embodiments, the fusosome has a level of miRNA content of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90% or greater than that of the source cell, for example, by an Example 39 assay. In some modalities, the fusosome has a level of miRNA content of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the ori cell's miRNA content level - gem (for example, up to 100% of the source cell's miRNA content level), for example, by an Example 39 assay. In some embodiments, the fusosome has a total RNA content level of at least 1% , 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the cell's total RNA content level source (for example, up to 100% of the total RNA content level of the source cell), for example, as measured by an Example 108 assay.
[00240] [00240] In some embodiments, the fusosome has a proportion of soluble protein: not soluble within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than the original cell, for example, within 1% to 2%, 2% to 3%, 3% to 4%, 4% to 5%, 5 % to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80% or 80% to 90% of that of the source cell, for example, by an Example 47 assay. In the embodiments, the fusosome has a soluble: non-soluble protein ratio of about 0.3 to 0.8, 0.4 to 0, 7 or 0.5 to 0.6, for example, about 0.563, for example, by an Example 47 assay. In some embodiments, the fusosome population has (or is identified as having) a
[00241] [00241] In some embodiments, the fusosome has an LPS level less than 5%, 1%, 0.5%, 0.01%, 0.005%, 0.0001%, 0.00001% or less of the LPS content of the source cell, for example, as measured by mass spectrometry, for example, in a test of Example 48. In some embodiments, the fusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, phosphorylation of AKT in response to insulin or glucose (for example, labeled glucose, for example, 2-NBDG) in response to insulin, for example, at least 1%, 2%, 3%, 4%, 5 %, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% more than a negative control, for example, a similar fusosome in the absence of insulin, for example, using an Example 63 assay. In some embodiments, the fusosome targets tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, sis peripheral nervous system, skeletal muscle, endothelium, inner ear or eye, when administered to a subject, for example, a mouse, for example, in which at least 0.1%, 0.5%, 1%, 1, 5%, 2%, 2.5%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or 90% of the fusosomes in a population of administered fusosomes are present in the target tissue after 24, 48 or 72 hours, for example, by an Example 87 test or
[00242] [00242] In some modalities, the fusosome is not capable of transcription or has transcriptional activity of less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, or 90% of the transcriptional activity of a reference cell, for example, the source cell, for example, using an Example 19 assay. In some embodiments, the fusosome is not capable of nuclear DNA replication or has nuclear DNA replication less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the nuclear DNA replication of a reference cell, for example, the source cell, for example, using an Example 20 assay. In some embodiments, the fusosome lacks chromatin or has a chromatin content of less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the chromatin content of a reference cell, for example, the source cell, for example, using an assay of Example 37.
[00243] [00243] In some embodiments, a characteristic of a spindle sum is described by comparison with a reference cell. In the modalities, the reference cell is the source cell. In the modalities, the reference cell is a Hela, HEK293, HFF-1, MRC-5, WI-38, IMR 90, IMR 91, PER.C6, HT-1080 or BJ cell. In some embodiments, a characteristic of a population of fusosomes is described in comparison to a population of reference cells, for example, a population of source cells or a population of HeLla, HEK293, HFF-1, MRC-5, WI cells -38, IMR 90, IMR 91, PER.C6, HT-1080 or BJ.
[00244] [00244] In some modalities, the fusosome meets a pharmaceutical or good manufacturing practice (GMP) standard. In some modalities, the fusosome was made in accordance with good manufacturing practices (GMP). In some embodiments, the fusosome has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens. In some embodiments, the fusosome has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants. In some embodiments, the fusosome has low immunogenicity, for example, as described here.
[00245] [00245] In some embodiments, the immunogenicity of a fusosome composition is assessed by a serum inactivation assay (for example, an assay that detects antibody-mediated neutralization or complement-mediated degradation). In some
[00246] [00246] In some embodiments, the immunogenicity of a fusosome composition is assessed by detecting complement activation in response to fusosomes. In some modalities, fusosomes do not activate the complement or activate the complement at a level below a predetermined value. In some embodiments, the serum of a virgin fusosome subject (for example, human or mouse) is brought into contact with a test fusosome composition. In some embodiments, the serum of a subject who has received one or more administrations of fusosomes, for example, has received at least two administrations of fusosomes, is brought into contact with the test fusosome composition. In the modalities, the composition comprising serum and fusosomes is then tested for an activated complement factor (eg C3a),
[00247] [00247] In some embodiments, a fusosome or population of fusosomes will not be substantially inactivated by the serum. In some embodiments, a fusosome or population of fusosomes is resistant to serum inactivation, for example, as quantified according to the method described in Examples 167 or 168. In modalities, the fusosome or population of fusosomes is not substantially inactivated by the serum or is resistant to inactivation of the serum after multiple administrations of the fusosome or population of fusosomes to a subject, for example, according to the methods described herein. In some embodiments, a fusosome is modified to have reduced serum inactivation, for example, compared to a corresponding unmodified fososome, for example, after several administrations of the modified fusosome, for example, as quantified according to the method described in Example 167 or
[00248] [00248] In some embodiments, a fusosome does not substantially induce complement activity, for example, as measured according to the method described in Example 169. In some embodiments, a fusosome is modified to induce reduced complement activity compared to a corresponding unmodified fusosome. In modalities, complement activity is measured by determining the expression or activity of a complement protein (for example, DAF, proteins that bind to the decay accelerating factor (DAF, CD55), for example, protein 1 (FHL-1 ) similar to factor H (FH), C4b-binding protein (C4BP), complement receptor 1 (CD35), membrane cofactor protein (MCP, CD46), propectin (CD59), proteins that inhibit CD / enzymes C5 convertase from the classical and alternative complement pathway or proteins that regulate the MAC set) in a cell.
[00249] [00249] In some embodiments, the source cell is an endothelial cell, a fibroblast, a blood cell (for example, a macrophage, a neutrophil, a granulocyte, a leukocyte), a stem cell (for example, a stem cell mesenchymal stem, an umbilical cord stem cell, bone marrow stem cell, a hematopoietic stem cell, an induced pluripotent stem cell, for example, an induced pluripotent stem cell derived from a subject's cells), a cell -embryonic stem (for example, an embryonic yolk sac stem cell, placenta, umbilical cord, fetal skin, adolescent skin, blood, bone marrow, adipose tissue, erythropoietic tissue, hematopoietic tissue), a myoblast, a pa cell - renquimatous (for example, hepatocyte), an alveolar cell, a neuron (for example, a neuronal retinal cell), a precursor cell (for example, a retinal precursor cell, a myeloblast, myeloid precursor cells, a thymus a myocyte, a megacarytoblast, a promegacarioblast, a melanoblast, a lymphoblast, a bone marrow precursor cell, a normoblast or an angioblast), a parental cell (for example, a parental cardiac cell, a satellite cell , a peripheral cell, bone marrow stromal cell, pancreatic parental cell, parental endothelial cell, blast cell) or immortalized cell (for example, HeLa cell, HEK293, HFF-1, MRC-5, WI-38, IMR 90, IMR 91, PER.C6, HT-1080 or BJ). In some embodiments, the source cell is different from a 293 cell, HEK cell, human endothelial cell or human epithelial cell, monocyte, macrophage, dendritic cell or stem cell.
[00250] [00250] In some embodiments, the cell of origin expressed (for example, overexpressed) ARRDC1 or an active fragment or variant thereof. In some embodiments, the fusosome or fossosome composition has a fusogen to ARRDC1 ratio of about 1 to 3, 1a 10, 1a 100, 3a10.4a9.5a8.6a7.15a100.60 to 200.80 to 180, 100 to 160, 120 to 140, 3 to 100, 4 to 100, 5 to 100, 6 to 100, 15 to 100, 80 to 100, 3 to 200, 4 to 200, 5 to 200, 6 to 200, 15 to 200, 80 to 200, 100 to 200, 120 to 200, 300 to 1000, 400 to 900, 500 to 800, 600 to 700, 640 to 690, 650 to 680, 660 to 670, 100 to 10,000, or about 664 , 9, for example, by a mass spectrometry test. In some modalities, the level of ARRDC1 as a percentage of the total protein content is at least about 0.01%, 0.02%, 0.03%, 0.04%, 0.05%; 0.1%, 0.15%, 0.2%, 0.25%; 0.5%, 1%, 2%, 3%, 4%, 5%; or the level of ARRDC1 as a percentage of the total protein content is about 0.05 to 1.5%, 0.1% to 0.3%, 0.05 to 0.2%, 0.1 to 0 , 2%, 0.25 to 7.5%, 0.5% to 1.5%, 0.25 to 1%, 0.5 to 1%, 0.05 to 1.5%, 10% to 30 %, 5 to 20% or 10 to 20%, for example, by mass spectrometry, for example, as measured according to the method described in Example 166. In some embodiments, the composition of fososome or fusosome has a fusogen ratio for TSG101 of about 100 to 1,000, 100 to 400, 100 to 500, 200 to 400, 200 to 500, 200 to 1,000, 300 to 400, 1,000 to 10,000, 2,000 to 5,000, 3,000 to 4,000,
[00251] [00251] In some embodiments, the fusosome comprises a charge, for example, a therapeutic agent, for example, an endogenous therapeutic agent or an exogenous therapeutic agent. In some embodiments, the therapeutic agent is chosen from one or more proteins, for example, an enzyme, a transmembrane protein, a receptor, an antibody; a nucleic acid, for example, DNA, a chromosome (for example, a human artificial chromosome), RNA, MRNA, siRNA, miRNA or a small molecule. In some modalities, the therapeutic agent is an organelle different from a mythochondria, for example, an organelle selected from: nucleus, Golgi complex, lysosome, endoplasmic reticulum, vacuole, endosome, acrosome, autophagosome, centriole, glycosome, glyoxysome, hydrogenome, melanosome, mitosome, cnidocyst, peroxisome, proteasome, vesicle and stress granules. In some modalities, the organelle is a mitochondria.
[00252] [00252] In some embodiments, the fusosome enters the target cell through endocytosis, for example, in which the level of therapeutic agent delivered via an endocytic route is 0.01 to 0.6, 0.01 to 0.1 , 0.1 to 0.3 or 0.3 to 0.6, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than a reference cell treated with chloroquine in contact with fusosomes, for example, using an Example 91 assay. In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of fusosomes in a fusosome composition that enters a target cell enters via a non-endocytic pathway, for example, fusosomes enter the target cell by fusion with the cell surface. In some embodiments, the level of a therapeutic agent delivered by a non-endocytic route for a given fusosome is 0.1 to 0.95, 0.1 to 0.2, 0.2 to 0.3, 0.3 to 0.4, 0.4 to 0.5, 0.5 to 0.6, 0.6 to 0.7, 0.7 to 0.8, 0.8 to 0.9, 0.9 to 0 , 95, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than a reference cell treated with chloroquine, for example, using an Example 90 assay. In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of fusosomes in a fusosome composition that enters a target cell enters the cytoplasm (for example, does not enter an endosomal or lysosome). In some modalities, less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2% or 1% of fusosomes in a fusosome composition that enters a target cell, inserts an endosome or lysosome. In some modalities, the fusosome enters the target cell via a non-endocytic pathway, for example, where the level of therapeutic agent delivered is at least 90%, 95%, 98% or 99% of that of a reference cell treated with chloroquine, for example, using an Example 91 assay. In one embodiment, a fusosome delivers an agent to a target cell via a dinamine-mediated pathway. In one embodiment, the level of agent delivered through a measured dinamine pathway is in the range of 0.01 to 0.6, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater than treated Dynasore target cells placed in contact with similar fusosomes, for example, as measured in a Example 92 assay. In one embodiment, a fusosome delivers an agent to a target cell via macropinocytosis. In one embodiment, the level of agent delivered via macropinocytosis is in the range of 0.01 to 0.6, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than EIPA-treated target cells placed in contact with similar fusosomes, for example, as measured in an Example 92 assay. In one embodiment , a fusosome delivers an agent to a target cell via an actin-mediated pathway. In one embodiment, the agent level delivered via an actin-mediated route will be in the range of 0.01 to 0.6, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20% , 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than the target cells treated with Latrunculin B placed in contact with similar fusosomes, for example, as measured in an Example run 92.
[00253] [00253] In some embodiments, the fusosome has a density of <1, 1 to 1.1, 1.05 to 1.15, 1.1 to 1.2, 1.15 to 1.25, 1.2a 1.3, 1.25 to 1.35 or> 1.35 g / ml, for example, by an Example 33 assay.
[00254] [00254] In some embodiments, the fusosome composition comprises less than 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5% or 10% of source cells per protein mass or less than 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, 2 %, 2.5%, 3%, 4%, 5% or 10% of the cells have a functional nucleus. In some modalities, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%,
[00255] [00255] In some embodiments, the fusosome also comprises an exogenous therapeutic agent. In some embodiments, the exogenous therapeutic agent is chosen from one or more of a protein, for example, an enzyme, a transmembrane protein, a receptor, an antibody; a nucleic acid, for example, DNA, a chromosome (for example, a human artificial chromosome), RNA, mRNA, SIRNA, miRNA or a small molecule.
[00256] [00256] In the modalities, the fusosome enters the cell by endocytosis or by a non-endocytic pathway.
[00257] [00257] In some embodiments, the fusosome or fusosome composition is refrigerated or frozen. In embodiments, the fusosome does not comprise a functional nucleus, or the fusosome composition comprises a fusosome without a functional nucleus. In terms of modalities, the composition of the fusosome comprises less than 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3% , 4%, 5% or 10% cells of protein mass origin or less than 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5% or 10% of the cells have a functional nucleus. In the modalities, the fossa composition was maintained at said temperature for at least 1,2,3,6 or 12 hours; 1, 2, 3, 4, 5 or 6 days; 1, 2, 3 or 4 weeks; 1,2, 3 or 6 months; or 1, 2, 3, 4 or 5 years. In modalities, the fossosome composition has an activity of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the population's activity before maintenance at that temperature, for example, by one or more of:
[00258] [00258] i) ofusosome fuses at a higher rate with a target cell than with a non-target cell, for example, at least 1%, 2%, 3%, 4%, 5%, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times
[00259] [00259] ii) the fusosome fuses at a higher rate with a target cell than with other fusosomes, for example, by at least 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%, for example, in an example 54 trial;
[00260] [00260] iii) the fusosome fuses with the target cells at a rate such that an agent in the fusosome is delivered at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of target cells after 24, 48 or 72 hours, for example, in an Example 54 assay; or
[00261] [00261] iv) the fusogen is present in a copy number of at least, or not more than, 10, 50, 100, 500, 1,000, 2,000, 5,000,
[00262] [00262] In the modalities, the fusosome composition is stable at a temperature below 4ºC for at least 1, 2, 3, 6 or 12 hours; 1,2, 3, 4, 5 or 6 days; 1, 2, 3 or 4 weeks; 1, 2, 3 or 6 months; or 1, 2, 3, 4 or 5 years. In the modalities, the composition of the fusosome is stable at a temperature below -20ºC for at least 1,2,3,6 or 12 hours; 1, 2, 3, 4, 5 or 6 days; 1, 2, 3 or 4 weeks; 1, 2, 3 or 6 months; or 1, 2, 3, 4 or 5 years. In the modalities, the composition of the fusosome is stable at a temperature below -80ºC for at least 1, 2, 3, 6 or 12 hours; 1, 2, 3, 4, 5 or 6 days; 1, 2, 3 or 4 weeks; 1,2, 3 or 6 months; or 1, 2, 3, 4 or 5 years.
[00263] [00263] “In the modalities, one or more of:
[00264] [00264] i) cell of origin is different from a 293 cell;
[00265] [00265] ii) the original cell is not transformed or immortalized;
[00266] [00266] iii) the cell of origin is transformed or immortalized using a different method than immortalization mediated by adenovirus, for example, immortalized by spontaneous mutation or expression of telomerase;
[00267] [00267] iv) the fusogen is not VSVG, a SNARE protein or a granular secreting protein;
[00268] [00268] v) the therapeutic agent is different from Cre or EGFP;
[00269] [00269] vi) the therapeutic agent is a nucleic acid (for example, RNA, for example, mRNA, miRNA or siRNA) or an exogenous protein (for example, an antibody, for example, an antibody), for example plo, in the lumen; or
[00270] [00270] vii) ofusosome does not comprise mitochondria.
[00271] [00271] In the modalities, one or more of:
[00272] [00272] i) cell of origin is different from a 293 or HEK cell;
[00273] [00273] ii) the original cell is not transformed or immortalized;
[00274] [00274] iii) the cell of origin is transformed or immortalized using a different method than immortalization mediated by adenovirus, for example, immortalized by spontaneous mutation or expression of telomerase;
[00275] [00275] iv) fusogen is not a viral fusogen; or
[00276] [00276] v) the ofusosome has a different size between 40 and 150 nm, for example, greater than 150 nm, 200 nm, 300 nm, 400 nm or 500 nm.
[00277] [00277] In the modalities, one or more of:
[00278] [00278] i) the therapeutic agent is a soluble protein expressed by the cell of origin;
[00279] [00279] ii) the fusogen is not TAT, TAT-HA2, HA-2, gp41, Alzheimer's beta-amyloid peptide, a Sendai virus protein or amphipathic negative liquid peptide (WAE 11);
[00280] [00280] iii) fusogen is a mammalian fusogen;
[00281] [00281] iv) the fusosome comprises in its lumen a polypeptide selected from an enzyme, antibody or anti-viral polypeptide;
[00282] [00282] v) ofusosome does not comprise a protein transmitted
[00283] [00283] vi) the phantom does not comprise CD63 or GLUTA4 or the ptosis is less than or equal to 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5% or 10% CD63 (for example, about 0.048% or less), for example, as determined according to the method described in Example 157.
[00284] [00284] “In the modalities, the fusosome:
[00285] [00285] i) does not comprise a virus, is not infectious or does not spread in a host cell;
[00286] [00286] ii) it is not a viral vector
[00287] [00287] iji) is not a VLP (virus-like particles);
[00288] [00288] iv) does not comprise a viral structural protein, for example, a protein derived from gag, for example, a viral capsid protein, for example, a viral capsule protein, for example, a viral nucleocapsid protein, or wherein the amount of viral capsid protein is less than 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2% or 0.1% of the total protein, for example , by mass spectrometry, for example, using an Example 53 or 161 test;
[00289] [00289] v) does not comprise a viral matrix protein;
[00290] [00290] vi) does not comprise a non-structural viral protein; eg pol or a fragment or variant thereof, a viral reverse transcriptase protein, a viral integrase protein or a viral protease protein.
[00291] [00291] vii) does not comprise viral nucleic acid; for example, viral RNA or viral DNA;
[00292] [00292] viii) comprises less than 10, 50, 100, 500, 1,000,
[00293] [00293] ix) ofusossoma is not a virosome.
[00294] [00294] In some embodiments, the fusosome comprises (or is identified as comprising) less than about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of viral capsid protein (for example, about 0.05% of viral capsid protein). In the modalities, the viral capsid protein is the Capid of the Endogenous Rabbit Lentivirus Complex (RELIK) with Cyclophylline A. In the modalities, the proportion of viral capsid protein: total protein is (or is identified as being) about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or 0.1.
[00295] [00295] In some embodiments, the fusosome does not comprise (or is identified as not comprising) a gag protein or a fragment or variant thereof, or the amount of gag protein or fragment or variant thereof is less than 10%, 5% , 4%, 3%, 2%, 1%, 0.5%, 0.2% or 0.1% of the total protein, for example, by an Example 53 or 161 assay.
[00296] [00296] In the modalities, the ratio between the number of copies of fumogen and the number of copies of the viral structural protein in the fusosome is at least 1,000,000: 1, 100,000: 1, 10,000: 1, 1,000: 1, 100: 1, 50: 1, 20: 1, 10: 1, 5: 1 or 1: 1; or is between 100: 1 and 50: 1, 50: 1 and 201, 20: 1 and 10: 1, 10: 1 and 5: 1 or 1: 1. In the modalities, the ratio between the number of copies of the fusogen and the number of copies of the viral matrix protein in the fusosome is at least 1,000,000: 1, 100,000: 1,
[00297] [00297] In the modalities, one or more of:
[00298] [00298] i) the fusosome does not comprise a drop immiscible in water;
[00299] [00299] ii) the fusosome comprises an aqueous lumen and a hydrophilic exterior;
[00300] [00300] iii) fusogen is a protein fusogen; or
[00301] [00301] iv) the organelle is selected from a mitochondria, Golgi complex, lysosome, endoplasmic reticulum, vacuole, endosome, acrosome, autophagosome, centriole, glycosome, glyoxysome, hydrogensome, melanosome, mitosome, cnidocyst, peroxisome, proteasome, vesicle and stress granule.
[00302] [00302] In the modalities, one or more of:
[00303] [00303] i) ofusogen is a mammalian fusogen or a viral fusogen;
[00304] [00304] ii) the fusosome was not produced by loading it with a therapeutic or diagnostic substance;
[00305] [00305] ii) the cell of origin was not loaded with a therapeutic or diagnostic substance;
[00306] [00306] iv) the fusosome does not comprise doxorubicin, dexamethasone, cyclodextrin; polyethylene glycol, a micro RNA, for example, mMiR125, VEGF receptor, ICAM-1, E-selectin, iron oxide, a fluorescent protein, for example, GFP or RFP, a nanoparticle or an RNase, or does not comprise a shape exogenous from none of the above; or
[00307] [00307] v) the ofusosome further comprises an exogenous therapeutic agent with one or more post-translational modifications, for example, glycosylation.
[00308] [00308] In modalities, the fusosome is unilamellar or multilamellar.
[00309] [00309] In the modalities, the fusosome has a size, or the population of fusosomes has an average size, between about 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of the original cell value, for example, as measured by an Example 30 assay. In modalities, the fusosome has a size or the population of fusosomes has a medium size, which is less than about 0.01%, 0.05%, 0.1%, 0, 5%, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of the original cell value , for example, as measured by an Example 30 assay. In the embodiments, fusosomes are (or are identified as being) smaller in size than parental cells.
[00310] [00310] In the embodiments, the fusosome composition comprises (or is identified as comprising) a GAPDH concentration of about 35 to 40, 36 to 39, 37 to 38 or 37.2 ng / ml, for example, in an Example 149 trial. In the embodiments, the GAPDH concentration of the fusosome composition is (or is identified as being) within about 1%, 2%, 5%, 10% or 20% of the concentration of GAPDH of the source cells, for example, in an Example 149 assay. In the embodiments, the GAPDH concentration of the fusosome composition is (or is identified as being) at least 1%, 2%, 5%, 10% or 20% less than the GAPDH concentration of the source cells, for example, in an Example 149 assay. In the embodiments, the fusosome composition comprises (or is identified as comprising) less than about 30, 35, 40, 45 , 46, 47, 48, 49, 50, 55, 60, 65 or 70 µg of GAPDH per gram of total protein. In the embodiments, the fusosome composition comprises (or is identified as comprising) less than about 500, 250, 100 or 50 µg of GAPDH per gram of total protein. In the modalities, the parental cell comprises (or is identified as comprising) at least 1%, 2.5%, 5%, 10%, 15%, 20%, 30%, 50% or more GAPDH per protein total than the fusosome composition.
[00311] [00311] In the modalities, one or more of:
[00312] [00312] i) ofusosome is not an exosome;
[00313] [00313] ii) the fusosome is a microvesicle;
[00314] [00314] iii) the fusosome comprises a non-mammalian fusogen;
[00315] [00315] iv) the fusosome was designed to incorporate a fusogen;
[00316] [00316] v) ofusosome comprises an exogenous fusogen;
[00317] [00317] vi) the fusosome has a size of at least 80 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1200 nm, 1400 nm or 1500 nm, or a population of fusosomes has an average size of at least 80 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1200 nm, 1400 nm or 1500 nm;
[00318] [00318] vii) the fusosome comprises one or more organelles, for example, a mitochondria, Golgi complex, lysosome, endoplasmic reticulum, vacuole, endosome, acrosome, autophagosome, centriol, glycosome, glyoxysome, hydrogenosome, melanosome, myosome, cnidocyst, peroxisome, proteasome, vesicle, stress granule;
[00319] [00319] viii) the fusosome comprises a cytoskeleton or a component thereof, for example, actin, Arp2 / 3, formalin, coronary, dystrophin, keratin, myosin or tubulin;
[00320] [00320] ix) the fusosome, or a composition or preparation comprising a plurality of fusosomes, does not have a fluctuation density of 1.08 to 1.22 g / ml, or a density of at least 1.18 to 1.25 g / ml or 1.05 to 1.12 g / ml, for example, in a sucrose gradient centrifugation test, for example, as described in Théry et al., "Isolation and characterization of exosomes from cell culture supernatants and biological fluids ". Curr Protoc Cell Biol. April 2006; Chapter 3: Unit 3.22;
[00321] [00321] x) the lipid bilayer is enriched for ceramides or sphingomyelin or a combination of them in comparison to the original cell or the lipid bilayer is not enriched (for example, it is depleted) for glycolipids, free fatty acids or phosphatidyl serine or combination thereof, compared to the source cell;
[00322] [00322] xi) the fusosome comprises phosphatidyl serine (PS) or CD40 ligand or both of the PS and CDA40 ligand, for example, when measured in an Example 52 or 160 assay;
[00323] [00323] xii) the fusosome is enriched for PS compared to the source cell, for example, in a population of fusosomes of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% are positive for PS, for example, by an assay by Kanada M, et al. (2015) Differential destinations of biomolecules delivered to target cells via extracellular vesicles. Proc Natl Acad Sci USA 112: E1433-E1442;
[00324] [00324] xiii) the fusosome is substantially free of acetylcholinesterase (AChE) or contains less than 0.001, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.5 , 1, 2, 5, 10, 20, 50, 100, 200, 500 or 1000 units of AChE / ug protein activity, for example, by an Example 67 assay;
[00325] [00325] xiv) ofusosome is substantially free of a protein from the Tetraspanin family (for example, CD63, CD9 or CD81), an ESCRT-related protein (for example, TSG101, CHMP4A-B or VPS4B), Alix, TSG101, MHCI, MHCII, GP96, actinin-4, mitophylline, syntenin-1, TSG101, ADAM1O0, EHDA4, syntenin-1, TSG101, EHD1, flotillin-1, 70 kDa heat shock proteins (HSC70 / HSP73, HSP70 / HSP72) or any combination thereof, or contains less than 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 5% or 10% of any either individual exosomal marker protein and / or less than 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20% or 25 % of the total exosomal marker proteins of any of the said proteins are either de-enriched for any one or more of these proteins compared to the source cell or are not enriched for any or more of these proteins, for example, by an assay Example 44 or 157;
[00326] [00326] xv) ofusosome comprises a level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) below 500, 250, 100, 50, 20, 10.5 or 1 ng of GAPDH / ug of total protein or below the level of GAPDH in source cell, for example, less than 1%, 2.5%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%, less than the level of GAPDH per total protein in ng / ug in the source cell, for example, using an Example 45 assay;
[00327] [00327] xvi) ofusosome is enriched for one or more endoplasmic reticulum proteins (for example, calnexin), one or more proteasome proteins or one or more mitochondrial proteins or any combination thereof, for example, in which the amount calnexin is less than 500, 250, 100, 50, 20, 10, 5 or 1 ng of Calnexin / ug of total protein or where the fusosome comprises less Calnexin per total protein in ng / ug compared to the cell source by 1%, 2.5%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%, for example, using an assay Example 46 or 158, or where the average fractional content of Calnexin in the
[00328] [00328] xvil) the fusosome comprises an exogenous agent (for example, an exogenous protein, MRNA or siRNA), for example, as measured using an Example 39 or 40 assay; or
[00329] [00329] —xvili) the fusosome can be immobilized on a mica surface by atomic force microscopy for at least 30 min, for example, by an assay by Kanada M, et al. (2015) Different destinations of biomolecules delivered to target cells via extracellular vesicles. Proc Natl Acad Sci USA 112: E1433 - E 1442.
[00330] [00330] “In the modalities, one or more of:
[00331] [00331] i) ofusosome is an exosome;
[00332] [00332] ii) the fusosome is not a microvesicle;
[00333] [00333] li) the fusosome is smaller than 80 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1200 nm, 1400 nm or 1500 nm, or a population of fusosomes has an average size less than 80 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1200 nm, 1400 nm or 1500 nm;
[00334] [00334] iv) ofusosome does not comprise an organelle;
[00335] [00335] v) ofusosome does not comprise a cytoskeleton or a component thereof, for example, actin, Arp2 / 3, formalin, coronary, dystrophin, keratin, myosin or tubulin;
[00336] [00336] vi) the fusosome, or a composition or preparation comprising a plurality of fusosomes, has a fluctuation density of 1.08 to 1.22 g / ml, for example, in a centrifugation assay in a gradient of sucrose, for example, as described in Théry et al., "Isolation and characterization of exosomes from cell culture su-
[00337] [00337] vii) the lipid bilayer is not enriched (for example, it is depleted) for ceramides or sphingomyelins or a combination of them compared to the source cell, or the lipid bilayer is enriched for glycolipids, free fatty acids or phosphatidylserine or a combination of them, compared to the original cell;
[00338] [00338] viii) the fusosome does not comprise, or is depleted in relation to the source cell, ligating phosphatidyl serine (PS) or CD40 or both of the ligand PS and CDA40, for example, when measured in an example 52 or 160 assay;
[00339] [00339] ix) the ofusosome is not enriched (for example, it is exhausted) for PS compared to the original cell, for example, in a population of fusosomes less than 20%, 30%, 40%, 50%, 60% , 70%, 80% or 90% are positive for PS, for example, by an assay by Kanada M, et al. (2015) Differential destinations of biomolecules delivered to target cells via extracellular vesicles. Proc Natl Acad Sci USA 112: E1433-E1442;
[00340] [00340] x) ofusosome comprises acetylcholinesterase (AChE), for example, at least 0.001, 0.002, 0.005, 0.01, 0.02, 0.05, 0.1, 0.2, 0.5, 1, 2 , 5, 10, 20, 50, 100, 200, 500 or 1000 units of AChE activity / ug of protein, for example, by an Example 67 assay;
[00341] [00341] xi) the fusosome comprises a protein from the Transtransin family (for example, CD63, CD9 or CD81), a protein related to ESCRT (for example, TSG101, CHMP4A-B or VPS4B), Alix, TSG101, MHCI, MHCII, GP96, actinin-4, mitophylline, syntenin-1, TSG101, ADAM1O, EHDA, syntenin-1, TSG101, EHD1, flotillin-1, 70 kDa heat shock proteins (HSC70 / HSP73, HSP70 / HSP72) or any combination thereof, for example, contains more than
[00342] [00342] xii) the fusosome comprises a level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) above 500, 250, 100, 50, 20, 10.5 or 1 ng of GAPDH / ug of total protein or below the level of GAPDH in the source cell, for example, at least 1%, 2.5%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% , greater than the GAPDH level per total protein in ng / ug in the source cell, for example, using an Example 45 assay;
[00343] [00343] —xiii) the ofusosome is not enriched for (for example, depleted) one or more endoplasmic reticulum proteins (for example, calnexin), one or more proteasome proteins or one or more mitochondrial proteins or any combination thereof, for example, where the amount of calnexin is less than 500, 250, 100, 50, 20, 10, 5 or 1 ng of total Calnexin protein / ug, or where the fusosome comprises less Calnexin per total protein in ng / ug compared to the source cell by 1%, 2.5%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%, for example, using an Example 46 or 158 assay, or where the average fractional content of Calnexin in the fusosome is less than about 1X107, 1.5xX107, 2x107, 2.1x1074, 2.2x107, 2, 3x107, 2.4x107, 2.43x10 "1, 2.5xX104, 2.6x107, 2.7x107, 2.8x107, 2.9x107%, 3x107, 3.5x10 * Or 4x104, or where the fusosome comprises a amount of Calexin per total protein less than that of the parental cell by about 70%, 75%, 8 0%, 85%, 88%, 90%, 95%, 99% or more; or
[00344] [00344] —xiv) the ofusosome cannot be immobilized on a mica surface by atomic force microscopy for at least 30 min., For example, by an assay by Kanada M, et al. (2015) Differential destinations of biomolecules delivered to target cells via extracellular vesicles. Proc Natl Acad Sci USA 112: E1433 - E 1442.
[00345] [00345] “In the modalities, the average fractional content of calnexin in the fusosome is (or is identified as being) less than about 1X107, 1.5xX107, 2x107, 2.1x1074, 2.2x104, 2.3x107, 2 , 4x107, 2.43x10 "1, 2.5x107, 2.6x107, 2.7xX107, 2.8x104, 2.9x107%, 3x10%, 3.5x10 * Or 4x10º *. In the modalities, the fusosome comprises a quantity calnexin per total protein lower than that of the parental cell by about 70%, 75%, 80%, 85%, 88%, 90%, 95%, 99% or more.
[00346] [00346] In the modalities, one or more of:
[00347] [00347] i) ofusosome does not comprise a VLP;
[00348] [00348] ii) the fusosome does not comprise a virus;
[00349] [00349] iii) the fusosome does not comprise a virus capable of replication;
[00350] [00350] iv) the fusosome does not comprise a viral protein, for example, a viral structural protein, for example, a capsid protein or a viral matrix protein;
[00351] [00351] v) ofusosome does not comprise a capsid protein of a virus involved;
[00352] [00352] vi) the fusosome does not comprise a nucleocapsid protein; or
[00353] [00353] vii) ofusogen is not a viral fusogen.
[00354] [00354] In the modalities, the fusosome comprises cytosol.
[00355] [00355] In the modalities, one or more of:
[00356] [00356] i) ofusosome or the originating cell does not form a teratome when implanted in the subject, for example, by an Example 102 test;
[00357] [00357] ii) the fusosome is capable of chemotaxis, for example, 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 90%, 100% or greater than a reference cell, for example, a macrophage, for example, using an Example 58 assay;
[00358] [00358] iji) the fusosome is able to approach, for example, at the site of an injury, where the fusosome or cytobiological is a human cell, for example, using an Example 59 assay, for example, in which source cell is a neutrophil; or
[00359] [00359] iv) the fusosome is capable of phagocytosis, for example, where phagocytosis by the fusosome is detectable within 0.5, 1, 2.3, 4, or 6 hours using an Example 60 assay, for example example, where the source cell is a macrophage.
[00360] [00360] In modalities, the composition of fusosome or fusosome maintains one, two, three, four, five, six or more of any of the characteristics for 5 days or less, for example, 4 days or less, 3 days or less, 2 days or less, 1 day or less, for example, about 12 to 72 hours, after administration to a subject, for example, a human subject.
[00361] [00361] In modalities, the fusosome has one or more of the following characteristics:
[00362] [00362] a) comprises one or more endogenous proteins of a cell of origin, for example, membrane proteins or cytosolic proteins;
[00363] [00363] Db) comprises at least 10, 20, 50, 100, 200, 500,
[00364] [00364] c) comprises at least 1, 2, 5, 10, 20, 50 or 100 different glycoproteins;
[00365] [00365] d) at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% by weight of the proteins in the fusosome are naturally occurring proteins;
[00366] [00366] e) comprises at least 10, 20, 50, 100, 200, 500, 1000, 2000 or 5000 different RNAs; or
[00367] [00367] f) comprises at least 2, 3, 4, 5, 10 or 20 different lipids, for example, selected from CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS , PA, PC, PE, PG, PI, PS, CE, SM and TAG.
[00368] [00368] In the modalities, the fusosome was manipulated to have, or the fusosome is not a naturally occurring cell and has, or in which the nucleus does not naturally have one, two, three, four, five or more of the following properties:
[00369] [00369] a) partial nuclear inactivation results in a reduction of at least 50%, 60%, 70%, 80%, 90% or more in nuclear function, for example, a reduction in DNA transcription or replication, or both , for example, where transcription is measured by an Example 19 assay and DNA replication is measured by an Example 20 assay;
[00370] [00370] b) ofusosome is not capable of transcription or has transcriptional activity of less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of that of the transcriptional activity of a reference cell, for example, the source cell, for example, using an Example 19 assay;
[00371] [00371] c) ofusosome is not capable of nuclear DNA replication or has nuclear replication less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80% or 90% of the nuclear DNA replication of a reference cell, for example, the source cell, for example, using an Example 20 assay;
[00372] [00372] d) ofusosome lacks chromatin or has a chromatin content of less than 1%, 2.5% 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the value of the chromatin content of a reference cell, for example, the source cell, for example,
[00373] [00373] e) ofusosome does not have a nuclear membrane or has less than 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2% or 1% of the amount of nuclear membrane of a reference cell, for example, the source cell or a Jurkat cell, for example, by an assay in Example 36;
[00374] [00374] fo fusosome lacks functional complexes of nuclear pores or reduced nuclear import or export activity, for example, by at least 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3 %, 2% or 1% by an Example 36 assay, or the fusosome lacks or more than one nuclear pore protein, for example, NUP98 or Importin 7;
[00375] [00375] g) ofusosome does not comprise histones or has histone levels below 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80% or 90% of the histone level of the source cell (for example, H1, H2a, H2b, H3 or H4), for example, by a test from Example 37;
[00376] [00376] h) the fusosome comprises less than 20, 10, 5, 4, 3, 20 or 1 chromosome;
[00377] [00377] i) the nuclear function is eliminated;
[00378] [00378] j) ofusosome is an enucleated mammalian cell;
[00379] [00379] Kk) the nucleus is removed or inactivated, for example, extruded by mechanical force, by radiation or by chemical ablation; or
[00380] [00380] 1) ofusosome is from a mammalian cell with DNA that is completely or partially removed, for example, during interphase or mitosis.
[00381] [00381] In the modalities, the fusosome comprises mtDNA or vector DNA. In modalities, the fusosome does not comprise DNA.
[00382] [00382] “In the modalities, the source cell is a primary cell, immortalized cell or a cell line (for example, myelobast cell line, for example, C2C12). In the modalities, the fusosome is from a cell of origin with a modified genome, for example, with reduced immunogenicity (for example, by editing the genome, for example, to remove an MHC protein or MHC complexes). In the modalities, the cell of origin is from a cell culture treated with an anti-inflammatory signal. In the embodiments, the cell of origin is from a cell culture treated with an immunosuppressive agent. In the embodiments, the cell of origin is substantially non-immunogenic, for example, using an assay described herein. In the embodiments, the cell of origin comprises an exogenous agent, for example, a therapeutic agent. In the embodiments, the source cell is a recombinant cell.
[00383] [00383] In embodiments, the fusosome further comprises an exogenous agent, for example, a therapeutic agent, for example, a protein or nucleic acid (for example, a DNA, a chromosome (for example, a human artificial chromosome) , an RNA, for example, an mRNA or miRNA). In the modalities, the exogenous agent is present in at least, or not more than 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000,
[00384] [00384] In the modalities, the active agent is selected from a protein, protein complex polypeptide (for example, comprising at least 2, 3, 4, 5, 10, 20 or 50 proteins, for example, at least 2, 3, 4, 5, 10, 20 or 50 different proteins), nucleic acid (eg DNA, chromosome or RNA, eg mRNA, siRNA or miRNA) or small molecule. In modalities, the exogenous agent comprises a site specific nuclease, for example, Cas9, TALEN or ZFN molecule.
[00385] [00385] In modalities, fusogen is a viral fusogen, for example, HA, HIV-1 ENV, HHV-4, gp 120 or VSV-G. In the modalities, the fusogen is a mammalian fusogen, for example, a SNARE, a Syncytin, myomaker, myomixer, myomerger or FGFRL1. In modalities, fusogen is active at a pH of 4 to 5.5 to 6.6 to 7.7 to 8.8 to 9 or 9 to 10. In modalities, fusogen is not active to a pH of 4 to 5.5 to 6.6 to 7.7 to 8 to 90 or 10 . In the modalities, the fusosome merges with a target cell on the surface of the target cell. In modalities, fusogen promotes fusion independently of the | isosome. In modalities, fusogen is a protein fusogen.
[00386] [00386] In the modalities, the fusosome binds a target cell. In the embodiments, the target cell is different from a HeLa cell or the target cell is not transformed or immortalized.
[00387] [00387] In some modalities involving fossa compositions, the plurality of fusosomes is the same. In some modes, the plurality of fusosomes is different. In some modes, the plurality of fusosomes are from one or more cells of origin. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the fusosomes in the plurality have a diameter within 10%, 20%, 30%, 40% or 50 % of the average diameter of the fusosomes in the fusosome composition. In some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the fusosomes in plurality have a volume within 10%, 20%, 30%, 40% or 50% of the average volume of the fusosomes in the fusosome composition. In some embodiments, the fusosome composition is less than about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%,
[00388] [00388] In some embodiments, the composition of the fusosome delivers the charge at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90 %, 95%, 96%, 97%, 98% or 99% of the number of cells in the target cell population compared to the reference target cell population.
[00389] [00389] In some embodiments, the fusosome composition provides at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the load for the target cell population compared to the reference target cell population or a non-target cell population. In some embodiments, the fusosome composition provides at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96 %, 97%, 98% or 99% more of the load for the cell-population
[00390] [00390] In some embodiments, less than 10% of the charge enters the cell through endocytosis.
[00391] [00391] In some embodiments, the endocytosis inhibitor is an inhibitor of lysosomal acidification, for example, bafilomycin A1. In some embodiments, the endocytosis inhibitor is a dynamin inhibitor, for example, Dynasore.
[00392] [00392] In some embodiments, the target cell population is at a physiological pH (for example, between 7.3 to 7.5, for example, between 7.38 to 7.42).
[00393] [00393] In some embodiments, the delivered charge is determined using an endocytosis inhibition assay, for example, an Example 90, 92 or 135 assay.
[00394] [00394] In some embodiments, the charge enters the cell via a pathway independent of dinamine or a pathway independent of lysosomal acidification, a pathway independent of macropinocytosis (for example, where the endocytosis inhibitor is an inhibitor of macropinocytosis, for example 5- (N-ethyl-N-isopropyl) amyloride (EIPA), for example, at a concentration of 25 µM) or an actin-independent pathway (for example, where the endocytosis inhibitor is a polymerization inhibitor of actin is, for example, Latrunculin B, for example, at a concentration of 6 µM).
[00395] [00395] In some embodiments, fusosomes of plurality further comprise a chemical portion of targeting. In modalities, the chemical targeting portion is composed of the spindle or is composed of a separate molecule.
[00396] [00396] In some embodiments, when the plurality of spindles are brought into contact with a cell population comprising target cells and non-target cells, the charge is present in at least 10 times more target cells than non-target cells .
[00397] [00397] In some embodiments, when the plurality of spindles are brought into contact with a population of cells comprising target cells and non-target cells, the charge is present at least 2 times, 5 times, 10 times, 20 times or 50 times higher in target cells than non-target cells and / or the charge is present at least 2 times, 5 times, 10 times, 20 times or 50 times more in target cells than in cells of reference.
[00398] [00398] In some embodiments, fusosomes of plurality fuse at a higher rate with a target cell than with a non-target cell by at least 50%.
[00399] [00399] In some embodiments, the presence of charge is measured by microscopy, for example, using an Example 124 assay. In some embodiments, fusion is measured by microscopy, for example, using an Example 54 assay.
[00400] [00400] In some embodiments, the targeting chemical portion is specific for a cell surface marker on the target cell. In modalities, the cell surface marker is a cell surface marker for a skin cell, cardiomyocytes, hepatocyte, intestinal cell (for example, small intestine cells), pancreatic cells, brain cells, prostate cells , lung cells, colon cells, or bone marrow cell.
[00401] [00401] In some embodiments, the fusogen (eg, redirected spindle) comprises a rhabdoviridae fusogen (eg VSV-G), a filoviridae fusogen, an arena-viridae fusogen, a togaviridae fusogen, a flaviviridae fusogen, flaviviridae fusogen, bunyaviridae fusogen or hapad-naviridae fusogen (eg, Hep B), or a derivative thereof.
[00402] [00402] In some embodiments, the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a population of reference target cells not treated with the inhibitor endocytosis, delivers the charge to at least 30% of the number of cells in the target cell population compared to the reference target cell population.
[00403] [00403] In some embodiments, the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a population of reference target cells not treated with the inhibitor endocytosis, delivers at least 30% of the load in the target cell population compared to the reference target cell population.
[00404] [00404] In some embodiments, the fusosome, when in contact with a population of target cells, delivers charge to a target cell site that is not an endosome or lysosome, for example, to the cytosol. In the modalities, less 50%, 40%, 30%, 20% or 10% of the cargo are delivered to an endosome or lysosome.
[00405] [00405] In some embodiments, the amount of viral capsid protein in the fusosome composition is determined using mass spectrometry, for example, using an Example 53 or 161 assay.
[00406] [00406] In some embodiments, fusosomes of plurality comprise exosomes, microvesicles or a combination thereof.
[00407] [00407] In some embodiments, the plurality of fusosomes has an average size of at least 50 nm, 100 nm, 200 nm, 500 nm, 1000 nm, 1200 nm, 1400 nm or 1500 nm. In other modalities, the plurality of fusosomes has an average size of less than 100 nm, 80 nm, 60 nm, 40 nm or 30 nm.
[00408] [00408] In some embodiments, the source cell is selected from a neutrophil, a HEK293 cell, a granulocyte, a cell
[00409] [00409] In some embodiments, fusosomes in plurality comprise cytobiologicals. In some embodiments, fusosomes in plurality comprise enucleated cells.
[00410] [00410] In some modalities, the fusogen (for example, redirected fusogen) comprises a mammalian fusogen. In some embodiments, fusogen (eg, redirected fusogen) comprises viral fusogen. In some embodiments, the spindle (for example, redirected fusogen) is a protein fusogen. In some embodiments, fusogen (for example, redirected fusogen) comprises a chosen sequence of a Nipah virus F protein, a measles virus F protein, a paramyxovirus F tupaia F protein, a paramyxovirus F protein, a protein Hendra virus F protein, a Henipavirus Protein F, a morbilivirus F protein, a respirovirus F protein, a Sendai virus F protein, a rubulavirus F protein or an avulavirus F protein or a derivative thereof .
[00411] [00411] In some modalities, fusogen (for example, redirected spindle) is active at a pH of 4a 5.5a6.6a7.7a8.8a9 or 9 to 10. In some modalities, fusogen (for example, spindle) redirected genius) is not active at a pH of 4a 5.5a6.6a7.7a 8.8a90u9gal10.
[00412] [00412] In some embodiments, fusogen is present in a number of copies of at least 1, 2, 5 or 10 copies per spindle sum.
[00413] [00413] In some embodiments, the fusogen (for example, redirected spindle) comprises a Nipah virus G protein, a measles H protein, a Tupaia Paramyxovirus H protein, a Paramyxovirus G protein, a Paramyxovirus H protein, a protein - Íína Paramyxovirus HN, a Morbilivirus H protein, an HN protein of respirovirus, an HN sendai protein, an HN protein of rubella-virus, an HN protein of avulavirus or a derivative thereof. In some embodiments, fusogen (for example, redirected fusogen) comprises a sequence chosen from proteins F and G of the Nipah virus, proteins F and H of the measles virus, proteins F and H, proteins F and H of the tupaia paramyxoviruses, para-mixovirus proteins F and G or proteins F and H or proteins F and HN, proteins F and G of Hendra virus, proteins F and G of Henipavirus, proteins F and H of morbilivirus, protein F and HN of respirovirus, protein F and HN of the Sendai virus, proteins F and HN of the Sendai virus, proteins F and HN of the rubulavirus or avenavirus F and HN proteins, or a derivative thereof, or any combination thereof.
[00414] [00414] In some embodiments, the charge comprises an exogenous protein or an exogenous nucleic acid. In some modalities, the charge comprises or encodes a cytosolic protein. In some embodiments, the charge comprises or encodes a membrane protein. In some embodiments, the charge comprises a therapeutic agent. In some embodiments, the charge is present in a number of copies of at least 1, 2, 5, 10, 20, 50, 100 or 200 copies per fusosome (for example, up to about 1,000 copies per fusosome). In some modalities, the ratio between the number of copies of the fusogen (for example, redirected fusogen) and the number of copies of the load is between 1000: 1 and 1: 1 or between 500: 1 and 1: 1 or between 250 : 1 and 1: 1 or between 150: 1 and 1: 1 or between 100: 1 and 1: 1 or between 75: 1 and 1: 1 or between 50: 1 and 1: 1 or between 25: 1 and 1: 1 or between 20: 1 and 1: 1 or between 15: 1 and 1: 1 or between 10: 1 and 1: 1 or between 5: 1 and 1: 1 or between 2: 1 and 1: 1 or between 1: 1 and 1: 2.
[00415] [00415] In some embodiments, the composition of fusosome:
[00416] [00416] a) meets a pharmaceutical standard or good manufacturing practices (GMP);
[00417] [00417] Db) was made according to good manufacturing practices (GMP);
[00418] [00418] c) it has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens; or
[00419] [00419] d) it has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants.
[00420] [00420] In some embodiments, the fusosome composition is at a temperature below 4, 0, -4, -10, -12, -16, -20, -80 or - 160ºC.
[00421] [00421] In some embodiments, the fusosome composition comprises a viral capsid protein or a DNA integrating polypeptide. In some embodiments, the payload comprises a viral genome.
[00422] [00422] In some embodiments, the fusosome composition is capable of delivering a nucleic acid to a target cell, for example, to stably modify the genome of the target cell, for example, for gene therapy.
[00423] [00423] In some embodiments, the fusosome composition does not comprise a viral nucleocapsid protein or the amount of viral nucleocapsid protein is less than 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1% of the total protein, for example, by mass spectrometry, for example, using an Example 53 or 161 assay.
[00424] [00424] In the modalities, a pharmaceutical composition described here has one or more of the following characteristics:
[00425] [00425] a) the pharmaceutical composition meets a pharmaceutical standard
[00426] [00426] b) the pharmaceutical composition was made in accordance with good manufacturing practices (GMP);
[00427] [00427] c) the pharmaceutical composition has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens;
[00428] [00428] d) the pharmaceutical composition has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants; or
[00429] [00429] e) the pharmaceutical composition has low immunogenicity, for example, as described herein.
[00430] [00430] In the embodiments, the charge of the pharmaceutical composition comprises a therapeutic agent.
[00431] [00431] In the modalities, the biological function is selected from:
[00432] [00432] a) modulate, for example, inhibit or stimulate an enzyme;
[00433] [00433] b) modular, for example, increasing or decreasing levels of a molecule (for example, a protein, nucleic acid or metabolite, medication or toxin) in the subject, for example, inhibiting or stimulating synthesis or inhibiting or encouraging factor degradation;
[00434] [00434] c) modular, for example, increasing or decreasing the viability of a target cell or tissue; or
[00435] [00435] d) modulating a protein state, for example, increasing or decreasing protein phosphorylation or modulating protein conformation;
[00436] [00436] e) to promote the healing of an injury;
[00437] [00437] ff) modular, for example, to increase or decrease, an interaction between two cells;
[00438] [00438] g) modular, for example, promoting or inhibiting, cell differentiation;
[00439] [00439] h) alteration of the distribution of a factor (for example, a protein, nucleic acid, metabolite, medication or toxin) in the subject;
[00440] [00440] i) modular, for example, increasing or decreasing an immunological response; or
[00441] [00441] j) modular, for example, increasing or decreasing the recruitment of cells to a target tissue.
[00442] [00442] In some modalities of the therapeutic methods presented here, the plurality of fusosomes has a local effect. In some embodiments, the plurality of fusosomes has this effect.
[00443] [00443] In some modalities, the subject has cancer, an inflammatory disorder, autoimmune disease, a chronic disease, inflammation, damaged organ function, an infectious disease, metabolic disease, degenerative disorder, genetic disease (for example , a genetic deficiency, a recessive genetic disorder or a dominant genetic disorder) or an injury. In some modalities, the subject has an infectious disease and the fusosome comprises an antigen for the infectious disease. In some embodiments, the subject has a genetic deficiency and the fusosome comprises a protein for which the subject is deficient, or a nucleic acid (for example, MRNA) that encodes the protein, or a DNA that encodes the protein. - na or a chromosome that encodes the protein, or a nucleus comprising a nucleic acid that encodes the protein. In some modalities, the subject has a dominant genetic disorder and the fusosome comprises a nucleic acid inhibitor (for example, siRNA or MIRNA) from the dominant mutant allele. In some embodiments, the subject has a dominant genetic disorder and / or the fusosome comprises a nucleic acid inhibitor (eg siRNA or miRNA) from the dominant mutant allele and / or the fusosome also comprises an mMRNA that encodes a unmuted allele of the mutated gene that is not targeted by the nucleic acid inhibitor. In some modalities, the subject needs vaccination. In some modalities, the subject needs regeneration, for example, from an injured site.
[00444] [00444] In some embodiments, the fusosome composition is administered to the subject at least 1, 2, 3, 4 or 5 times.
[00445] [00445] In some embodiments, the fusosome composition is administered to the subject systemically (for example, orally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally) or locally. In some modalities, the composition of the fusosome is administered to the subject so that the composition of the fusosome reaches a selected target tissue of the liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, organs reproductive systems, central nervous system, peripheral nervous system, skeletal muscle, endothelium, inner ear or eye. In some embodiments (for example, in which the subject has an autoimmune disease), the fusosome composition is co-administered with an immunosuppressive agent, for example, a glucocorticoid, cytostatic, antibody or immunophilin modulator. In some modalities (for example, in which the subject has a cancer or an infectious disease), the composition of the fusosome is co-administered with an immunostimulating agent, for example, an adjuvant, interleukin, cytokine or chemokine. In some embodiments, administration of the fusosome composition results in positive or negative regulation of a gene in a target cell in the subject, for example, in which the fusosome comprises a transcriptional activator or repressor, a translational activator or repressor or an epigenetic activator or repressor.
[00446] [00446] In some modalities of the manufacturing methods here, supply a cell of origin that expresses a fusogen comprising
[00447] [00447] In the modalities, does the fusosome composition comprise at least 10º, 106, 107, 108, 10º, 10% º, 1011, 1072, 10%, 10 * º or 10º fusosomes. In the embodiments, the composition of the fusosome comprises at least 10 ml, 20 ml, 50 ml, 100 ml, 200 ml, 500 ml, 11, 21, 51, 101, 201 or 50 | In the embodiments, the method comprises enuclearing the mammalian cell, for example, by chemical enucleation, use of mechanical force, for example, use of a filter or centrifuge, at least partial disruption of the cytoskeleton or a combination thereof. In the modalities, the method comprises expressing a fungus or other membrane protein in the cell of origin. In the modalities, the method comprises one or more among: vesiculation, hypotonic treatment, extrusion or centrifugation. In the embodiments, the method comprises genetically expressing an exogenous agent in the cell or loading the exogenous agent into the cell or the fusosome. In the modalities, the method comprises the contact of the cell (for example, the cell of origin) with the DNA that encodes a polypeptide agent, for example, before inactivating the nucleus, for example, enuclear the cell (for example, the source cell). In the modalities, the method comprises the contact of the cell with the RNA that encodes a polypeptide agent, for example, before or after inactivating the nucleus, for example, enuclear the cell. In the embodiments, the method comprises introducing a therapeutic agent (for example, a nucleic acid or protein) into a fusosome, for example, by electroporation.
[00448] [00448] In the modalities, the fusosome is from a mammalian cell with a modified genome, for example, to reduce immunogenicity (for example, by editing the genome, for example, to re-
[00449] [00449] In some embodiments, if a detectable level, for example, a value above a reference value, is determined, a sample containing the plurality of fusosomes or composition of fusosomes is discarded.
[00450] [00450] In some embodiments, the first fusogen is not a lipopeptide.
[00451] [00451] In some modalities of the methods of assessing the fusosome content of a target cell (for example, fusosome fusion with a target cell), resulting in the formation of a receptor cell in the subject, the method still comprises collect the subject's biological sample. In the embodiments, the biological sample includes one or more recipient cells.
[00452] [00452] In some embodiments of methods for assessing the fusosome content of a target cell (e.g., fusion-sum fusion with a target cell) in the subject, the method further comprises separating recipient cells in the biological sample from unfused fusosomes in the biological sample, for example, by centrifugation. In some modalities, the method also comprises enriching recipient cells in relation to non-fused fusosomes in the biological sample, for example, by centrifugation. In some embodiments, the method further comprises enriching target cells relative to non-target cells in the biological sample, for example, by FACS.
[00453] [00453] In some modalities of methods for assessing the content of the fusosome of a target cell (for example, fusion of the fusosome with a target cell) in a subject, the activity related to the composition of the fusosome is chosen from the presence or level of a metabolite, presence or level of a biomarker (for example, protein level or post-translational modification, for example, phosphorylation or cleavage).
[00454] [00454] In some modalities of methods for assessing the fusosome content of a target cell (eg, fusosome fusion with a target cell) in a subject, the activity related to the fusosome composition is immunogenicity. In the modalities, the target cell is a CD3 + cell and the biological sample is a blood sample taken from the subject. In the modalities, blood cells are enriched from the blood sample, for example, using a buffered ammonium chloride solution. In the modalities, the enriched blood cells are incubated with an anti-CD3 antibody (for example, a murine anti-CD3-FITC antibody) and the CD3 + cells are selected, for example, by fluorescence-activated cell classification . In modalities, cells, for example, cells classified, for example, CD3 + cells, are analyzed for the presence of antibodies on the cell surface, for example, by staining with an anti-IgM antibody. In some modalities, if the antibodies are present at a level above a reference level, the subject is identified as having an immune response against recipient cells.
[00455] [00455] In the modalities, immunogenicity is assessed by a cell lysis assay. In modalities, the recipient cells of the biological sample are co-incubated with immune effector cells capable of lysing other cells. In modalities, the immune effector cells are from the subject or from a non-administered subject with a fusosome composition. For example, in modalities, immunogenicity is assessed by a PBMC cell lysis assay. In modali-
[00456] [00456] In some embodiments, immunogenicity is assessed by phagocytosis of recipient cells, for example, by macrophages. In the modalities, the recipient cells are not directed by macrophages to phagocytosis. In the modalities, the biological sample is a blood sample collected from the subject. In the modalities, blood cells are enriched from the blood sample, for example, using a buffered ammonium chloride solution. In the embodiments, the enriched blood cells are incubated with an anti-CD3 antibody (for example, a murine anti-CD3-FITC antibody) and the CD3 + cells are selected, for example, by fluorescence-activated cell classification. In the modalities, fluorescence-labeled CD3 + cells are incubated with macrophages and then tested for intracellular fluorescence within macrophages, for example, by flow cytometry. In some modalities, if macrophage phagocytosis occurs at a level above a reference level, the subject is identified as having an immune response against recipient cells.
[00457] [00457] In some embodiments, the methods described herein comprise measuring or determining the fusosome content of a target cell, for example, fusion of a fusosome with a target cell (for example, determining whether the fusion has occurred ), for example, as described in Example 54 or 124. In the embodiments, a detectable marker may be present in the fusosome (for example, conjugated to a charge or payload molecule in the fusosome). In embodiments where the payload or payload comprises a protein, the payload or payload can be detected directly, for example, using a chemical binding portion (for example, an antibody or an antigen binding fragment thereof). In certain embodiments, a protein payload is associated with (e.g., conjugated to) a detectable chemical moiety, for example, a chemical moiety that can be specifically linked by an antibody molecule. In modalities in which the payload or payload comprises a nucleic acid (for example, DNA or mRNA), the payload or payload can be detected using a nucleic acid probe capable of hybridizing to the nucleic acid or using a chemical binding portion (for example, an antibody, or its antigen binding fragment) capable of specifically binding to a polypeptide encoded by the nucleic acid. In embodiments, the fusion of the fusosome with the target cell is determined by the detection of the detectable marker. In embodiments, the fusion of the fusosome to the target cell is determined by measuring the expression of the charge or charge (for example, a non-coding polypeptide or RNA encoded by a charge or charge of nucleic acid). In the modalities, the fusion of the fusosome to the target cell is determined by measuring a marker downstream of the charge or payload activity. In some modalities, target cells or recipient cells are isolated from a subject before measuring or determining the fusogen content of a target cell or recipient cell, for example, fusion of a spindle-sum with a cell -target. In embodiments, the target cell or recipient cells are also stained with an endosomal or lysosomal antibody or dye to determine whether the payload is present in an endosome or lysosome. In some modalities, the payload does not colocalize with the endosome or lysosome, or less than 50%, 40%, 30%, 20%, 10%, 5%, 2% or 1% of the colocalized payload with the endosome or lysosome . In the modalities, the receiving cells are also stained with a cytoplasmic, nuclear, mitochondrial or plasma membrane antibody or dye to determine whether the payload is placed in a target compartment, such as the cytoplasm, nucleus, mitochondria or plasma membrane; in such modalities, the payload would be located with the nucleus, mitochondria or plasma membrane.
[00458] [00458] “In the modalities, a method of manufacturing fusosomes in this document comprises the expression (for example, overexpression) of ARRDC1 or an active fragment or variant thereof in an originating cell. In the modalities, the method also comprises the separation of fusosomes from the cells of origin that express ARRDC1. In modalities, the method produces at least 1.2x1071, 1.4x107, 1.6x107, 1.8x107 !, 2.0x10, 2.2x10! 1, 2.4x10, 2.6x10 "or 2.8x10 particles per ml , for example, up to about 3x10 * particles per ml. In some embodiments, the method produces about 1.2, 1.4, 1.6, 1.8, 2, 3, 4, 5, 6, 7 , 8, 9 or 10 times more particles per ml than the same method performed with similar cells of origin that do not express or do not overexpress ARRDC1 or an active fragment or variant thereof. In some modalities, the fusosomes produced from the source cells they understand the expression (for example, overexpression) of ARRDC1 or an active fragment or variant thereof, when in contact with target cells, produces detectable charge delivery in at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 times more cells than fusosomes produced from cells of similar and wise origin that do not express or do not overexpress ARRDC1 or an active fragment or variant thereof, for example, using a microscopy assay, for example, an Example 170 assay. LISTED MODALITIES
[00459] [00459] 1. Fusosome composition comprising a plurality of fusosomes derived from a cell of origin, wherein the fusosomes of the plurality comprise:
[0001] [0001] a lipid bilayer,
[0002] [0002] a lumen comprising cytosol, in which the lumen is surrounded by the lipid bilayer;
[0003] [0003] an exogenous or overexpressed fusogen disposed in the lipid bilayer,
[0004] [0004] one charge; and
[00460] [00460] wherein the fusosome does not comprise a nucleus;
[00461] [00461] wherein the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein;
[00462] [00462] in which the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a reference cell population of reference not treated with the endocytosis inhibitor, delivers the load to at least 30% of the number of cells in the target cell population compared to the reference target cell population.
[00463] [00463] 2. The fusosome composition of modality 1, which
[00464] [00464] 3. The fusosome composition of modality 1 or 2, in which less than 10% of the charge enters the cell by endocytosis.
[00465] [00465] 4.The fusosome composition of any of the previous modes, in which the endocytosis inhibitor is an inhibitor of lysosomal acidification, for example, bafilomycin A1.
[00466] [00466] 5. The fusosome composition of any of the above modes, in which the delivered charge is determined using an endocytosis inhibition assay, for example, an Example 90 or 135 assay.
[00467] [00467] 6.The fusosome composition of any of the previous patterns, in which the charge enters the cell via a dinamine-independent pathway or an independent lysosomal acidification pathway, an macropinocytosis-independent pathway (for example, in that the endocytosis inhibitor is a macropinocytosis inhibitor, for example 5- (N-ethyl-N-isopropyl) amyloride (EIPA), for example, at a concentration of 25 µM) or an actin-independent pathway (for example, wherein the endocytosis inhibitor is an inhibitor of the actin polymerization is, for example, Latrunculin B, for example, at a concentration of 6 µM).
[00468] [00468] 7.The fusosome composition of any of the previous modes, in which the fusosomes of the plurality still comprise a target chemical moiety.
[00469] [00469] 8. The fusosome composition of modality 7, in which the target chemical moiety is composed of fusogen or is composed of a separate molecule.
[00470] [00470] 9. The fusosome composition of any of the above, wherein, when the plurality of fusosomes is brought into contact with a population of cells comprising target cells and non-target cells:
[0001] [0001] the charge is present in at least 10 times more target cells than non-target cells, or
[0002] [0002] the charge is present at least 2 times, 5 times, 10 times, 20 times or 50 times more in the target cells than in the non-target cells and / or in the reference cells.
[00471] [00471] 10.The fusosome composition of any of the previous modalities, in which the fusosomes of the plurality fuse at a higher rate with a target cell than with a non-target cell by at least 50%.
[00472] [00472] 11. Fusosome composition that comprises a plurality of fusosomes derived from a cell of origin and in which the fusosomes of the plurality comprise: (a) a lipid bilayer, (b) a lumen comprising cytosol, in which the lumen is surrounded by the lipid bilayer; (c) an exogenous redirected or overexpressed fusogen arranged in the lipid bilayer; (d) a charge; and
[00473] [00473] in which the fusosome does not comprise a nucleus;
[00474] [00474] wherein the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein;
[00475] [00475] where:
[00476] [00476] (i) when the plurality of fusosomes are brought into contact with a population of cells comprising target cells and cells
[00477] [00477] (ii) the fusosomes of the plurality fuse at a higher rate with a target cell than with a non-target cell in at least 50% or at least 50% more charge is delivered to the population of cells compared to a reference cell population.
[00478] [00478] 12.The fusosome composition of modality 11, wherein the presence of charge is measured by microscopy, for example, using an Example 124 assay.
[00479] [00479] 13. The fusosome composition of modality 11, wherein the fusion is measured by microscopy, for example, using an Example 54 assay.
[00480] [00480] 14.The fusosome composition of any of the modalities 7 to 13, in which the chemical targeting portion is specific for a cell surface marker on the target cell.
[00481] [00481] 15.The fusosome composition of modality 14, wherein the cell surface marker is a cell surface marker of a skin cell, cardiomyocytes, hepatocyte, intestinal cell (e.g., small intestine cells), pancreatic cells , brain cells, prostate cells, lung cells, colon cells, or bone marrow cell.
[00482] [00482] 16.The fusosome composition of any of the modalities 11 to 15, in which the fusogen (for example, redirected fusogen) comprises a fusogen of rhabdoviridae (e.g. VSV-G), a fusogen of filoviridae, a fusogen of arenaviridae , a togaviridae fusogen, a flaviviridae fusogen, a bun-yaviridae fusogen or a hapadnaviridae fusogen (for example, Hep B) or a derivative thereof.
[00483] [00483] 17.The fusosome composition of any of the modalities 7 to 16, in which the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a population of reference target cells not treated with the endocytosis inhibitor:
[00484] [00484] (i) delivers the charge to at least 30% of the number of cells in the target cell population compared to the reference target cell population,
[00485] [00485] (ii) delivers at least 30% of the load to the target cell population compared to the target target cell population; or
[0001] [0001] (iii) delivers at least 30% more of the load to the target cell population compared to the reference target cell population.
[00486] [00486] 18.The fusosome composition of any of the previous modalities, in which, when in contact with a population of target cells, it delivers cargo to a location of the target cell with the exception of an endosome or lysosome, for example, for cytosol.
[00487] [00487] 19.The fusosome composition of modality 18, in which 50%, 40%, 30%, 20% or 10% less of the load is delivered to an endosome or lysosome.
[00488] [00488] 20.The fusosome composition of any of the foregoing embodiments, wherein the amount of viral capsid protein in the fusosome composition is determined using mass spectrometry, for example, using an Example 53 or 161 assay; and / or
[00489] [00489] wherein the fusosome composition does not comprise a viral nucleocapsid protein or the amount of viral nucleocapsid protein is less than 10%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2% or 0.1% total protein, for example, by mass spectrometry, for example, using an Example 53 or 161 assay.
[00490] [00490] 21.The fusosome composition of any of the previous modalities, in which the plurality fusosomes comprise exosomes, microvesicles or a combination thereof.
[00491] [00491] 22.The fusosome composition of any of the previous modalities, in which the plurality of fusosomes have an average size of at least 50 nm, 100 nm, 200 nm, 500 nm, 1,000 nm, 1,200 nm , 1,400 nm or 1,500 nm.
[00492] [00492] 23.The fusosome composition of any of the modalities 1 to 21, wherein the plurality of fusosomes has an average size of less than 100 nm, 80 nm, 60 nm, 40 nm or 30 nm.
[00493] [00493] 24.The fusosome composition of any of the previous modalities, in which the source cell is selected from a neutrophil, a HEK293 cell, a granulocyte, a mesenchymal stem cell, a stem cell from bone marrow, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, a myoblast, a hepatocyte or a neuron, for example, neuronal retinal cell.
[00494] [00494] 25.The fusosome composition of any of the previous modalities, in which the plurality of fusosomes comprise cytobiologicals.
[00495] [00495] 26.The fusosome composition of any of the previous modalities, in which the plurality of fusosomes comprise enucleated cells.
[00496] [00496] 27.The composition of fususes of any of the previous modalities, in which fusogen (for example, redirected fusogen) comprises a mammalian fusogen.
[00497] [00497] 28.The fusosome composition of any of the previous modalities, in which the fusogen (for example, redirected fusogen) comprises a viral fusogen.
[00498] [00498] 29. The fusosome composition of any of the previous modalities, in which fusogen (for example, redirected fusogen) is active at a pH of 4a 5.5a6.6a7.7a8.8a90ou9a
[00499] [00499] 30.The fusosome composition of any of the previous modalities, in which the fusogen (for example, redirected fusogen) is not active at a pH of 4a 5.5a6.6a7.7a8.8a9 or 9a 10.
[00500] [00500] 31.The fusosome composition of any of the previous modalities, in which fusogen (for example, redirected fusogen) is a protein fusogen.
[00501] [00501] 32.The fusosome composition of any of the previous modalities, in which the fusogen (for example, redirected fusogen) comprises a sequence chosen from a protein Nipah virus, a protein F of the virus measles, a paramyxovirus tupaia F protein, a paramyxovirus F protein, a Hendra virus F protein, a Henipavirus F protein, a morbilivirus F protein, a respirovirus F protein, a Sendai virus F protein, a rubulavirus F protein or an avulavirus F protein or a derivative thereof.
[00502] [00502] 33. The fusosome composition of any of the previous modalities, in which fusogen is present in a number of copies of at least 2, 5 or 10 copies per fusosome.
[00503] [00503] 34.The fusosome composition of any of the previous modalities, in which the fusogen (for example, redirected fusogen) comprises a protein G of the Nipah virus, a protein H of measles, a protein H of the paramyxovirus tupaia, a paramyxovirus G protein, a paramyxovirus H protein, a paramyxovirus HN protein, a morbilivifus H protein, a respirovirus HN protein, a sendai HN protein, a HN protein
[00504] [00504] 35.The fusosome composition of any of the previous modalities, in which the fusogen (for example, redirected fusogen) comprises a chosen sequence of proteins F and G of the Nipah virus, proteins F and H of the virus measles, paramyxovirus Fupa and H proteins, paramyxovirus F and G proteins or F and H proteins or F and HN proteins, Hendra virus F and G proteins, Henipavirus F and G proteins, F and G proteins of morbilivirus, morbilivirus F and H proteins, respirovirus F and HN protein, Sendai virus F and HN protein, rubulavirus Proteins F and HN, or avulavirus F and HN proteins, or a derivative thereof, or any combination thereof of them.
[00505] [00505] 36.The fusosome composition of any of the above modalities, wherein the charge comprises an exogenous protein or an exogenous nucleic acid.
[00506] [00506] 37.The fusosome composition of any of the above modalities, wherein the charge comprises or encodes a cytosolic protein or a membrane protein.
[00507] [00507] 38.The fusosome composition of any of the previous modalities, wherein the charge comprises a therapeutic agent.
[00508] [00508] 39.The fusosome composition of any of the previous modes, in which the charge is present in a number of copies of at least 1, 2, 5, 10, 20, 50, 100, or 200 copies per fossosome (for example, up to about 1,000 copies per fusosome).
[00509] [00509] 40.The fusosome composition of any of the previous modalities, in which the ratio between the number of copies of the fumogen (for example, redirected fusogen) and the number of copies of the charge is between 1000: 1 and 1: 1, between 500: 1 and 1: 1, between 250: 1 and 1: 1, between 150: 1 and 1: 1, between 100: 1 and 1: 1, between 75: 1 and 1: 1, between 50: 1 and 1: 1,
[00510] [00510] 41.The fusosome composition of any of the previous modalities, in which one or more of:
[00511] [00511] a) the fusosome composition has a fusogen to CD63 ratio of about 100 to 10,000, 500 to 5,000, 1000 to 5000, 2000 to 4000, 2500 to 3500, 2900 to 2930, 2910 to 2915 or 2912 , 0, for example, by a mass spectrometry test; or
[00512] [00512] b) the fusosome composition has a protein to CD63 charge ratio of about 5 to 35, 10 to 30, 15 to 25, 16 to 19, 18 to 19 or 18.6; or
[00513] [00513] c) less than 15%, 20% or 25% of the protein in the fusosome is exosomal protein.
[00514] [00514] 42.The fusosome composition of any of the previous modalities, in which one or more of:
[0001] [0001] a) fusogen comprises about 1 to 30%, 5 to 20%, 10 to 15%, 12 to 15%, 13 to 14% or 13.6% of the total protein in a fusosome, for example, by a mass spectrometry test;
[0002] [0002] b) fusogen has a GAPDH ratio of about 20 to 120, 40 to 100, 50 to 90, 60 to 80, 65 to 75, 68 to 70 or 69, for example, by a mass spectrometry assay ;
[0003] [0003] c) fusogen has a CNX ratio of about 200 to 900, 300 to 800, 400 to 700, 500 to 600, 520 to 590, 530 to 580, 540 to 570, 550 to 560 or 558.4, for example, by a mass spectrometry test;
[00515] [00515] d) at least 1%, 2%, 3%, 4%, 5%, 6%, 7% 8%, 9% or 10% of the protein in the fusosome is ribosomal protein or about 1% to 20%, 3% to 15%, 5% to 12.5%, 7.5% to 11% or 8.5% to 10.5% or 9% to 10% of the protein in the fusosome is the ribosomal protein.
[00516] [00516] 43.The fusosome composition of any of the
[00517] [00517] 44. The fusosome composition of any of the previous modalities, which has a fusogen to AR-RDC1 ratio of about 1 to 3, 1a 10, 1a100.3a10.4a9.5a8.6a7.15 a 100, 60 to 200, 80 to 180, 100 to 160, 120 to 140, 3 to 100.4 to 100.5 to 100, 6 to 100, 15 to 100, 80 to 100, 3 to 200, 4 to 200, 5 to 200, 6 to 200, 200, 80 to 200, 100 to 200, 120 to 200, 300 to 1000, 400 to 900, 500 to 800, 600 to 700, 640 to 690, 650 to 680, 660 to 670 , 100 to 10,000 or 664.9, for example, by a mass spectrometry assay.
[00518] [00518] 45.The fusosome composition of any of the previous modalities, in which the level of ARRDC1 as a percentage of the total protein content is at least about 0.01%, 0.02%, 0 , 03%, 0.04%, 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20% or 25%; or the level of ARRDC1 as a percentage of the total protein content is about 0.01 to 25%, 0.5% to 20%, 2% to 15% or 5% to 10%.
[00519] [00519] 46.The fusosome composition of any of the previous modalities, which has a fusogen to tsg 101 ratio of about 1,000 to 10,000, 2,000 to 5,000, 3,000 to 4,000, 3,050 to
[00520] [00520] 47. The fusosome composition of any of the previous modalities, which has a load ratio for tsg101 of about 10 to 30, 15 to 25, 18 to 21, 19 to 20 or 19.5 , for example, using a mass spectrometry assay, for example, an Example 163 assay.
[00521] [00521] 48.The fusosome composition of any of the previous modalities, in which the TSG101 level as a percentage
[00522] [00522] 49.The fusosome composition of any of the previous modalities, which:
[00523] [00523] e) meets a pharmaceutical standard or good manufacturing practices (GMP);
[00524] [00524] ff) was made in accordance with good manufacturing practices (GMP);
[00525] [00525] g) it has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens; or
[00526] [00526] h) it has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants.
[00527] [00527] 50.The fusosome composition of any of the previous modalities, which is at a temperature below 4, 0, -4, - 10, -12, -16, -20, -80 or -160ºC.
[00528] [00528] 51. A pharmaceutical composition comprising the fusosome composition of any of the above modalities and pharmaceutically acceptable carrier.
[00529] [00529] 52.The pharmaceutical composition of modality 51, wherein the filler comprises a therapeutic agent.
[00530] [00530] 53. Method for delivering a therapeutic agent to a subject, comprising administering to the subject a pharmaceutical composition of modality 52, in which the fusosome composition is administered in an amount and / or time such that the therapeutic agent is delivered.
[00531] [00531] 54. Method for making a fusosome composition,
[00532] [00532] 55. Method for making a fusosome composition, comprising: a) providing a fusosome composition of any one of embodiments 1 to 50; and b) testing one or more fusosomes of the plurality to determine the presence or level of one or more of the following factors: (i) an immunogenic molecule; (ii) a pathogen; or (iii) a contaminant; and Cc) approve the plurality of fusosomes or fossosome composition for release if one or more of the factors is below a reference value.
[00533] [00533] 56. Fusosome composition comprising a plurality of fusosomes derived from a cell of origin and wherein the fusosomes of the plurality comprise:
[00534] [00534] (a) a lipid bilayer,
[00535] [00535] (b) a lumen surrounded by the lipid bilayer;
[00536] [00536] (c) an exogenous or overexpressed fusogen, in which the fumogen is disposed in the lipid bilayer; and
[00537] [00537] (d) a charge;
[00538] [00538] wherein the fusosome does not comprise a nucleus; and
[00539] [00539] where one or more of (for example, at least 2, 3, 4 or of):
[00540] [00540] i) fusogen is present in a number of copies of at least 1,000 copies;
[00541] [00541] ii) the fusosome comprises a therapeutic agent with a copy number of at least 1,000 copies;
[00542] [00542] ii) the fusosome comprises a lipid in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA, PC, PE, PG, PI, PS, CE, SM and TAG are within 75% of the corresponding lipid level in the source cell;
[00543] [00543] iv) the fusosome comprises a proteomic composition similar to that of the original cell;
[00544] [00544] v) ofusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, AKT phosphorylation in response to insulin or glucose uptake (for example, labeled glucose, for example, 2-NBDG ) in response to insulin, for example, at least 10% more than a negative control, for example, a similar fososome in the absence of insulin;
[00545] [00545] vi) the fusosome targets a tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, nervous system peripheral, skeletal muscle, endothelium, inner ear or eye, when administered to a subject, for example, a mouse, for example, in which at least 0.1% or 10% of fososomes in a population of administered fusosomes are present in the target tissue after 24 hours; or
[00546] [00546] vii) cell of origin is selected from a neutrophil, a granulocyte, a mesenchymal stem cell, a bone marrow stem cell, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, a myoblast, a hepatocyte or a neuron, for example, a neuronal cell in the retina.
[00547] [00547] 57.The fusosome composition of modality 56, which comprises a viral capsid protein or a DNA integrating polypeptide.
[00548] [00548] 58.The fusosome composition of modality 56, wherein the payload comprises a viral genome.
[00549] [00549] 59. The fusosome composition of modality 56, which is capable of delivering a nucleic acid to a target cell, for example, to stably modify the genome of the target cell, for example, for gene therapy.
[00550] [00550] Other characteristics, objects and advantages of the invention will be evident from the description and drawings and the claims.
[00551] [00551] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as is commonly understood by one skilled in the art to which this invention belongs. All publications, patent applications, patents and other references mentioned here are incorporated by reference in their entirety. For example, all GenBank, Unigene and Entrez strings mentioned here, for example, in any Table here, are incorporated by reference. Unless otherwise stated, the sequence access numbers specified here, including in any Table in this document, refer to the current database entries as of May 8, 2017. When a gene or protein references a plurality of sequence access numbers, all sequence variants are included. In addition, the materials, methods and examples are illustrative only and are not intended to limit. BRIEF DESCRIPTION OF THE DRAWINGS
[00552] [00552] The following detailed description of the invention will be better understood when read in conjunction with the attached drawings. In order to illustrate the invention, certain modalities are shown in the drawings described here, which are currently exemplified. It should be understood, however, that the invention is not limited to the precise arrangement and instrumentalities of the modalities shown in the drawings.
[00553] [00553] Figure 1 quantifies the staining of the fusosomes with a dye for the endoplasmic reticulum.
[00554] [00554] Figure 2 quantifies the staining of fusosomes with a dye for mitochondria.
[00555] [00555] Figure 3 quantifies the staining of fusosomes with a dye for lysosomes.
[00556] [00556] Figure 4 quantifies the staining of the fusosomes with a dye for F-actin.
[00557] [00557] Figure5 is a graph showing the recovery of GFP fluoregency after photobleaching of cells in contact with fusogens that express Cre and GFP.
[00558] [00558] Figure 6 is a graph that shows the percentage of target cells that express RFP after contact with fusosomes or negative controls.
[00559] [00559] Figure 7 is an image of a positive delivery of organisms by fusion between donor and recipient HeLa cells. The intracellular areas indicated in white indicate overlap between the donor and recipient mitochondria. Gray intracellular regions indicate where donor and recipient organelles do not overlap.
[00560] [00560] Figure 8 is an image of a positive delivery of organisms by fusion between donor and recipient HeLa cells. The intracellular areas indicated in white indicate overlap between the donor and recipient mitochondria. Gray intracellular regions indicate where donor and recipient organelles do not overlap.
[00561] [00561] Figure 9 shows microscopic images of the indicated tissues of mice injected with fusosomes. The white indicates represents fluorescent RFP cells, indicating the delivery of a protein load to the cells in vivo.
[00562] [00562] Figure 10 is a series of images showing the successful delivery of fusosomes to murine tissues in vivo by the indicated routes of administration, resulting in the expression of small luciferase.
[00563] [00563] Figure 11 shows microscopic images of tdTomato fluorescence in murine muscle tissue, indicating the delivery of a protein load to muscle cells by cytobiologicals.
[00564] [00564] Figure 12 is a graph showing the delivery of mitochondria to recipient HeLa Rho0 cells using enucleated and protein-enhanced VSL-G HeLa cells.
[00565] [00565] Figure 13 is a series of images showing the generation and isolation of giant fusosomes from the plasma membrane.
[00566] [00566] Figure 14A is a graph showing the expression of RFP in HEK293T cells incubated with fusosomes containing Cre recombinase and generated by extrusion through membranes with pores of varying sizes, as indicated.
[00567] [00567] Figure 14B is a series of graphs showing Eu: 488 positive events (left panel) and median fluorescence intensity (MFI; right panel) of parental cells and fusosomes.
[00568] [00568] Figure 14C is a series of graphs showing Edu: 647 positive events and median fluorescence intensity of AF647 from parental cells and fusosomes.
[00569] [00569] Figure 14D is a graph showing the capacity of parental actin polymerase fusosomes and cells over a period of 3, 5 and 24 hours.
[00570] [00570] Figure 15 is an electron microscopy image showing fusosomes with a lipid bilayer structure.
[00571] [00571] Figure 16 is a diagram showing the detection of VSV-G expression by Western blot. "+ Control" represents VSV-G transfected 293T cells. "-Control" represents 293T cells not transferred.
[00572] [00572] Figure 17A is a table showing the submicron fusosome measurement parameters and settings.
[00573] [00573] Figure 17B is a table showing supra-micron fusosome measurement parameters and settings.
[00574] [00574] Figure 17C is a series of graphs showing the size distribution of fusosomes and parental cells, measured by ATN and microscopy.
[00575] [00575] Figure 17D is a table showing the average diameter of fusosomes and parental cells, measured by ATN and microscopy.
[00576] [00576] Figure 18 is a table showing the size distribution statistics of parental cells and fusosomes, as measured by ATN and microscopy.
[00577] [00577] Figure 19 is a table showing the average size and volume of fusosomes and parental cells.
[00578] [00578] Figures 20A to 20C are a series of graphs that show the detection of organelles in fusosomes. (A) endoplasmic reticulum; (B) mitochondria; (C) lysosomes.
[00579] [00579] Figure 21 is a series of diagrams showing the soluble: insoluble ratio observed for fusosomes or a cell preparation.
[00580] [00580] Figure 22 is a series of diagrams showing the fusion of MvH (CD8) + F fusions for target or non-target cells and absolute amount of targeted fusion.
[00581] [00581] Figure 23 is a diagram showing the expression of hox40L in PC3 cells treated with fusosomes.
[00582] [00582] Figure 24 is a diagram showing the average fluorescence intensity of 2-NBDG in VSV-G fusosomes.
[00583] [00583] Figure 25 is a diagram showing stasis activity in the cytosol of VSV-G fusosomes.
[00584] [00584] Figures 26A to 26B are a series of diagrams showing persistence of the firefly luciferase signal in the tissues of mice injected with fusosomes. (A) Ventral image and luminescent signal of treated fusosome (right leg) versus treated PBS (left leg) of FVB mice. The left side is an overlap of image and luminescent signal and the right side is only luminescent signal. (B) total flow signal of AT treated with fusosome (dark square), AT treated with PBS (open circle), mouse background (dark hexagon) and stage background (open hexagon); the y scale is on the log10 scale. The fusosome-treated leg had a significantly greater signal at 1 (p <0.0001), 6 (p <0.01) and 12 (p <0.01) hours after treatment.
[00585] [00585] Figures 27A to 27B are a series of diagrams showing the delivery of Cre recombinase by fusosomes, as detected by biolumniscent imaging in mice. (A) Ventral image and overlapping of luminescent signal of the exposed liver and spleen of mice treated with fusosome IV (1x and 3x concentration). The lower portion is a luminescent signal alone. (B) sign of total flow from the spleen and liver to the fusosome; the y scale is on the log10 scale. Mice treated with a 3-fold treatment concentration of fusosomes had a significantly greater sign in the spleen (p = 0.0004) than 72 hours after treatment.
[00586] [00586] Figures 28A to 28B are a series of diagrams showing Cre recombinase for liver and murine spleen by fusosomes, as detected by a bioluminescent image. (A) From left to right; dorsal image and overlapping luminous signal of liver, heart, lungs, kidney, small intestine, pancreas and spleen, collected and visualized within 5 minutes after euthanasia. The lower portion is a luminescent signal alone. (B) signal of total flow of the spleen, liver and other tissues directed to the fusosome; the y scale is on the log10 scale. Mice treated with a 3-fold fusosome treatment concentration had a significantly greater signal in the spleen (p <0.0001) compared to the tissue with the lowest signal (heart).
[00587] [00587] Figure 29 is a table showing the delivery of Cre charge by NivG + F fusosomes via a non-endocytic pathway.
[00588] [00588] Figure 30 is a series of images showing the delivery of Cre charge by VSV-G fusosomes via the endocytic pathway.
[00589] [00589] Figure 31 is a graph showing the delivery of functional mitochondria using fusosomes from Syn1 HeLa cells to HeLa Rho0 receptor cells.
[00590] [00590] Figure 32 is a series of images showing the in vitro delivery of DNA to recipient cells via fusosomes.
[00591] [00591] Figure 33 is a series of images showing the in vitro delivery of MRNA to recipient cells via fusosomes.
[00592] [00592] Figures 34A to 34B are a series of diagrams showing in vivo delivery of MRNA that encodes firefly luciferase in the tissues of mice using fusosomes. (A) Ventral image and luminescent signal of treated fusosome (right leg) versus treated PBS (left leg) of FVB mice. The left side is an image overlay and luminescent signal and the right side is only luminescent signal. (B) total flow signal of AT treated with fusosome (dark square), AT treated with PBS (open circle), mouse background (dark hexagon) and stage background (open hexagon); the y scale is on the log10 scale. The spindle-treated leg had a significantly greater signal at 1 (p <0.0001), 6 (p <0.01) and 12 (p <0.01) hours after treatment.
[00593] [00593] Figure 35 is a series of images showing the in vitro delivery of protein to recipient cells via fusosomes.
[00594] [00594] Figures 36A to 36B is a series of diagrams showing the in vivo delivery of Cre recombinase in the tissues of mice.
[00595] [00595] Figure 37 is a series of diagrams showing the delivery of miRFP670 DNA to recipient cells via fusosomes loaded by sonication.
[00596] [00596] Figure 38 is a series of diagrams showing the delivery of the BSA-AF647 protein to the recipient cells via fusosomes loaded by sonication.
[00597] [00597] Figure 39 is a histogram showing the size distribution and concentration of fusosome ghosts.
[00598] [00598] Figure 40 is a series of graphs showing Edu: 647 positive events and median fluorescence intensity of AF647 from parental cells and fusosomes.
[00599] [00599] Figure 41 is a graph that shows ratios of GA-PDH: total proteins measured by the bicinconinic acid test in fossa and parental cells.
[00600] [00600] Figure 42 is a graph showing the lipid ratios: proteins measured by the test for bicinconinic acid in fusosomes and parental cells.
[00601] [00601] Figure 43 is a graph showing the protein: DNA ratios measured by the bicinconinic acid test in fusosomes and parental cells.
[00602] [00602] Figure 44 is a graph showing the lipid: DNA ratios measured by the bicinconinic acid test on fusosomes and parental cells.
[00603] [00603] Figure 45 is a series of images showing the delivery of Cre to cells by VSV-G fusosomes in the presence or absence of the Dynasore dinamine inhibitor.
[00604] [00604] Figure 46 is a graph showing the protein levels of the CD63 exosome marker in exosomes and fusosomes.
[00605] [00605] Figure 47 is a graph showing the intensity of the calnexin signal detected in fusosomes and parental cells.
[00606] [00606] Figure 48 is a graph showing the lipid: DNA ratios determined for fusosomes and parental cells.
[00607] [00607] Figures 49A to 49B are a series of graphs that show the proportion of lipid species as a percentage of the total lipid in parental cells, exosomes and fusosomes.
[00608] [00608] Figure 50 is a series of graphs showing the protein content of parental cells, exosomes and fusosomes in relation to proteins associated with specific compartments, as indicated.
[00609] [00609] Figure 51 is a series of graphs showing the level of ARRDC1 (left panel) or TSG101 (right panel) as a percentage of the total protein content in parental cells, exosomes and fusosomes.
[00610] [00610] Figures 52A to 52B are a series of graphs showing the effect of incorporating protein 1 containing the stopin domain (ARRDC1) in the production of fusosomes that encapsulate Cre. (A) The percentage of positive RFP cells detected after incubation with fusosomes produced in the presence or absence of ARRDC1. (B) The number of particles per ml detected using Nanoparticle Tracking Analysis (fNTA) for fusosomes produced in the presence or absence of ARRDC1. DETAILED DESCRIPTION
[00611] [00611] The invention describes bilipid membranes naturally derived or manipulated that comprise a fusogen. DEFINITIONS
[00612] [00612] As used herein, a "cell membrane" refers to a membrane derived from a cell, for example, a source cell or a target cell.
[00613] [00613] As used here, a "chondrosome" is a sub-cellular device derived and isolated or purified from the mitochondrial network from a natural source of cell or tissue. A "chondroma preparation" has bioactivity (can interact or affect a cell or tissue) and / or pharmaceutical activity.
[00614] [00614] "As used here," cytobiological "refers to a portion of a cell that comprises a lumen and a cell membrane, or a cell with partial or complete nuclear inactivation. In some modalities, the cytobiological comprises one or more of a component of the cytoskeleton, an organelle and a ribosome. In modalities, the cytobiological is an enucleated cell, a microvesicle or a cellular ghost.
[00615] [00615] As used here, "cytosol" refers to the aqueous component of a cell's cytoplasm. The cytosol can comprise proteins, RNA, metabolites and ions.
[00616] [00616] An "exogenous agent", as used here, refers to an agent that: i) does not naturally exist, such as a protein that has a sequence that is altered (for example, by insertion, exclusion or substitution) in relation to to an endogenous protein, or ii) does not occur naturally in the naturally occurring cell of the fusosome in which the exogenous agent is disposed.
[00617] [00617] As used here, "fuse" denotes creating an interaction between two closed lumens per membrane, for example, facilitating the fusion of two membranes or creating a connection, for example, a pore, between two lumens.
[00618] [00618] As used here, "fusogen" refers to an agent or molecule that creates an interaction between two closed lumens per membrane. In modalities, fusogen facilitates the fusion of membranes. In other embodiments, fusogen creates a connection, for example, a pore, between two lumens (for example, the lumen of the spindle-sum and a cytoplasm of a target cell). In some modalities, fusogen comprises a complex of two or more proteins, for example, in which no protein has fusogenic activity alone. In some embodiments, fusogen comprises a targeting domain.
[00619] [00619] “As used here," fusogen binding partner "refers to an agent or molecule that interacts with a fusogen to facilitate the fusion between two membranes. In some embodiments, a fusogen-binding partner may be or comprise a cell's surface feature.
[00620] [00620] "As used here," fusosome "refers to a closed membrane preparation and a fusogen that interacts with the amphipathic lipid bilayer.
[00621] [00621] "As used herein," fusosome composition "refers to a composition that comprises one or more fusosomes.
[00622] [00622] “As used here," closed membrane preparation "refers to an amphipathic lipid bilayer that encloses a charge in a lumen or well. In some embodiments, the charge is exogenous to the lumen or well. In other modalities, the charge is endogenous to the lumen or well, for example, endogenous to a cell of origin.
[00623] [00623] “As used here," mitochondrial biogenesis "denotes the process of increasing the biomass of mitochondria. Mythochondrial biogenesis includes increasing the number and / or size of mitochondria in a cell.
[00624] [00624] “As used here, the term" purified "means changed or removed from the natural state. For example, a cell or cell fragment naturally present in a living animal is not "purified",
[00625] [00625] “As used in this document, a" redirected fusogen "refers to a fusogen that comprises a chemical targeting portion that has a sequence that is not part of the naturally occurring form of the fusogen. In modalities, fusogen comprises a chemical portion of different targeting compared to the targeting portion in the form of naturally occurring fusogen. In modalities, the naturally occurring form of the fusogen does not have a targeting domain, and the redirected fusogen comprises a chemical portion of targeting that is absent from the naturally occurring form of the fusogen. In modalities, fusogen is modified to comprise a targeting chemical portion. In modalities, fusogen comprises one or more sequence changes outside the targeting chemical portion in relation to the natural form of fusogen, for example, in a transmembrane domain, fusogenically active domain or cytoplasmic domain.
[00626] [00626] As used here, a "source cell" (used interchangeably with "parental cell") refers to a cell from which a fusosome is derived. FUSOSOMES
[00627] [00627] In some respects, the spindle compositions and methods described herein comprise membrane-closed preparations, for example, naturally derived or manipulated lipid membranes, comprising a fusogen. In some respects
[00628] [00628] In some modalities of the compositions and methods described here include fusosomes, for example, bilayer of natural derivatives or manipulated amphipathic lipids with a fusogen. Such compositions can surprisingly be used in the methods of the invention. In some cases, the membranes may take the form of an autologous, allogeneic, xenogenic or manipulated cell as described in Ahmad et al. 2014 Miro1 regulates intercellular mitochondrial transport and improves the efficiency of rescue of mesenchymal stem cells. EMBO newspaper. 33 (9): 994-1010. In some modalities, the compositions include membranes modified as described in, for example, Orive. et al. 2015. Cell encapsulation: technical and clinical advances. Trends in Pharmacological Sciences; 36 (8): 537 to 546; and in Mishra. 2016. Manual encapsulation and controlled release. CRC Press. In some embodiments, the compositions include naturally occurring membranes (McBride et al. 2012. A vesicular transport pathway transfers mitochondria loads to lysosomes. Current Biology 22: 135 to 141).
[00629] [00629] In some embodiments, a composition described herein includes a naturally derived membrane, for example, membrane vesicles prepared from cells or tissues. In a modality, the fusosome is a vesicle of MSCs or astrocytes.
[00630] [00630] In one embodiment, the fusosome is an exosome.
[00631] [00631] Exemplary exosomes and other membrane-closed bodies are described, for example, in US2016137716,
[00632] [00632] Exemplary exosomes and other membrane-closed bodies are also described in WO / 2017/161010, WO / 2016/077639, US2016016857 2, US20150290343 and US20070298118, each of which is incorporated by reference here in its entirety. In some embodiments, the fusosome comprises an extracellular vesicle, nanovesicle or exosome. In its modality, the fusosome comprises an extracellular vesicle, for example, a vesicle derived from cells that comprises a membrane that surrounds an internal space and has a smaller diameter than the cell from which it is derived. In the modalities, the extracellular vesicle has a diameter of 20nm to 1000 nm. In modalities, the fusosome comprises an apoptotic body, a fragment of a cell, a vesicle derived from a cell by direct or indirect manipulation, a vesiculated organelle and a vesicle produced by a living cell (for example, by direct budding of the membrane plasma or late endosome fusion with the plasma membrane). In modalities, the extracellular vesicle is derived from a living or dead organism, explanted tissues or organs or cultured cells. In modalities, the fusosome comprises a nanovesicle, for example, a small vesicle derived from a cell (for example, between 20 to 250 nm in diameter or 30 to 150 nm in diameter) comprising a membrane that surrounds an internal space and that is generated from said cell by direct or indirect manipulation. The production of new particles can, in some cases, result in the destruction of the original cell. The nanovesicle can comprise a lipid or fatty acid and polypeptide. In modalities, the fusosome comprises an exosome. In embodiments, the exosome is a small vesicle derived from a cell (for example, between 20 to 300 nm in diameter or 40 to 200 nm in diameter) comprising a membrane that surrounds an internal space and is generated from that cell by direct plasma budding or by fusion of the late endosome with the plasma membrane. In modalities, the production of exosomes does not result in the destruction of the source cell. In modalities, the exosome comprises lipid or fatty acid and polypeptide.
[00633] [00633] Exemplary exosomes and other membrane-closed bodies are also described in US 20160354313, which is incorporated here by reference in its entirety. In the modalities, the spindle-sum comprises a Biocompatible Delivery Module, an exosome (for example, about 30 nm to about 200 nm in diameter), a microvesicle (for example, about 100 nm to about 2000 nm in diameter) an apoptotic body (for example, about 300 nm to about 2000 nm in diameter), a membrane particle, a membrane vein, an exosome-type vesicle, an ectosome-type vesicle, an ectosome or an exovesicle.
[00634] [00634] In one embodiment, the fusosome is microvesicle. In some embodiments, the microvesicle is a subcellular or extracellular vesicle between about 10 and 10,000 nm in diameter. In some modalities, a microvesicle is released naturally from a cell and, in some modalities, the cell is treated to improve the formation of vesicles. In one embodiment, the fusosome is an exosome. In some cases, an exosome is between 30 and 100 nm in diameter. In some modalities, an exosome is generated from cor-
[00635] [00635] Fusosomes can be produced from several different types of lipids, for example, amphipathic lipids, such as phospholipids. The fusosome can comprise a lipid bilayer as the outermost surface. This bilayer can be composed of one or more lipids of the same or another type. Examples include, without limitation, phospholipids, such as phospholines and phosphoinositols. Specific examples include, without limitation, DMPC, DOPC and DSPC.
[00636] [00636] A fusosome can consist mainly of phospholipids and natural lipids, such as 1,2-distearoryl-sn-glycero-3-phosphatidyl choline (DSPC), sphingomyelin, phosphatidylcholines and monosialoganglioside. In the modalities, a fusosome comprises only phospholipids and is less stable in plasma. However, manipulation of the lipid membrane with cholesterol can, in modalities, increase stability and reduce the rapid release of the bioactive compound encased in the plasma. In some embodiments, the fusosome comprises 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), for example, to increase stability (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, 12 pages,
[00637] [00637] In some embodiments, fusosomes comprise or are enriched for lipids that affect the curvature of the membrane (see, for example, Thiam et al., Nature Reviews Molecular Cell Biology, 14 (12): 775 to 785 , 2013). Some lipids have a small hydrophilic group and large hydrophobic tails, which facilitate the formation of a fusion pore, focusing on a local region. In some embodiments, fusosomes comprise or are enriched for negative curvature lipids, such as cholesterol, phosphatidylethanolamine (PE), diglyceride (DAG), phosphatidic acid (PA), fatty acid (FA). In some embodiments, fusosomes do not understand, are depleted of, or have some positive-curvature lipids, such as lysophosphatidyloline (LPC), phosphatidylinositol (Ptdlhs), lysophosphatidic acid (LPA), lysophosphatidylethanolamine (LPE), monoacylglycerine! (MAG).
[00638] [00638] In some embodiments, lipids are added to a fusosome. In some embodiments, lipids are added to cells of origin in culture that incorporate lipids into their membranes before or during the formation of a fusosome. In some embodiments, lipids are added to cells or fusosomes in the form of a liposome. In some modalities methyl beta-cyclodextran (mB-CD) is used to enrich or deplete lipids (see, for example, Kainu et al, Journal of Lipid Research, 51 (12): 3533 to 3541, 2010).
[00639] [00639] Fusosomes can comprise, without limitation, DOPE (dioleoylphosphatidylethanolamine), DOTMA, DOTAP, DOTIM, DDAB, alone or together with cholesterol to produce DOPE and cholesterol, DOTMA and cholesterol, DOTAP and cholesterol, DOTIM and cholesterol, and DDARB and cholesterol. Methods for the preparation of lipids from the multilamellar vesicle are known in the art (see, for example, US Patent No. 6,693,086, whose teachings relating to the preparation of lipids from the multilamellar vesicle are incorporated herein by reference). Although the formation of fusosomes can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be accelerated by applying force in the form of agitation using a homogenizer, sonicator or an extrusion apparatus (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, 12 pages, 2011. doi: 10.1155 / 2011/469679 for review). Extruded lipids can be prepared by extruding through decreasing size filters, as described in Templeton et al., Nature Biotech, 15: 647 to 652, 1997, whose teachings relating to the preparation of extruded lipids are incorporated herein by reference.
[00640] [00640] In another modality, lipids can be used to form fusosomes. Lipids, including, but not limited to, DLin-KC2-DMAA, C12-200 and dysterylphosphatidyl choline, cholesterol and PEG-DMG colipids can be formulated (see, for example, Novobrantseva, Molecular The-rapy-Nucleic Acids (2012) 1 , e4; doi: 10.1038 / mtna.2011.3) using a spontaneous vesicle formation procedure. Tekmira publications describe various aspects of lipid vesicle and lipid vesicle formulations (see, for example, U.S. Patent Nos. 7,982,027; 7,799,565; 8,799,069; 8,283,333; 7,901./08;
[00641] [00641] In some embodiments, a fusosome described herein may include one or more polymers. Polymers can be biodegradable. Biodegradable polymeric vesicles can be synthesized using methods known in the art. Exemplary methods for synthesizing polymer vesicles are described by Bershteyn et al., Soft Matter 4: 1787 to 1787, 2008 and in US 2008/0014144 A1, whose specific teachings regarding the synthesis of microparticles are incorporated herein by reference.
[00642] [00642] “Examples of synthetic polymers that can be used include, without limitation, aliphatic polyesters, polyethylene glycol (PEG), poly (lactic acid) (PLA), poly (glycolic acid) (PGA), lactic acid and glycolic acid copolymers (PLGA), polycarprolactone (PCL), polyanhydrides, poly (ortho) esters, polyurethanes, poly (butyric acid), valeric polifacid) and poly (lactide-co-caprolactone) and natural polymers such as albumin, alginate and others polysaccharides, including dextran and cellulose, collagen, its chemical derivatives, including substitutions, additions of chemical groups such as alkyl, alkylene, hydroxylations, oxidations and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade by enzymatic hydrolysis or exposure to water in vivo, by surface erosion or in large volume. FUSOGEN
[00643] [00643] In some embodiments, the fusosome described herein (for example, comprising a vesicle or part of a cell) includes one or more fusogens, for example, to facilitate the fusion of the fusosome to a membrane, for example, a cell membrane . These compositions can also include surface modifications made during or after synthesis to include one or more fusogens, for example, fusogens can be complementary to a target cell. The surface modification may comprise a modification in the membrane, for example, insertion of a lipid or protein into the membrane.
[00644] [00644] In some embodiments, fusosomes comprise one or more fusogens on their outer surface (for example, integrated into the cell membrane) to target a specific type of cell or tissue (for example, cardiomyocytes). Fusogens include, without limitation, fusogenic ones based on proteins, lipids and chemicals. Fusogen can bind a partner to the surface of target cells. In some embodiments, the fusosome comprising the fusogen will integrate the membrane into a lipid bilayer of a target cell.
[00645] [00645] In some embodiments, one or more of the fusogens described herein can be included in the fusosome. PROTEIN FUSOGEN
[00646] [00646] In some embodiments, fusogen is a protein fusogen, for example, a mammalian protein or a homologue of a mammalian protein (for example, having 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater identity), a non-mammalian protein, such as a viral protein or a viral protein counterpart (for example, having 50%, 60 %, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater identity), a native protein or a derivative of a native protein, a synthetic protein, a fragment a variant thereof, a variant thereof, a fusion of proteins comprising one or more of the fumes or fragments and any combination thereof.
[00647] [00647] In some embodiments, fusogen results in the mixture between lipids in the fusosome and lipids in the target cell. In some modalities, fusogen results in the formation of one or more pores between the lumen of the fusosome and the cytosol of the target cell, for example, the fossosome is, or comprises, a connection as described herein. MAMMALIAN PROTEINS
[00648] [00648] In some embodiments, fusogen may include a mammalian protein, see Table 1. Examples of mammalian fusogens may include, but are not limited to, a protein in the SNARE family such as vSNARESs and tSNAREs, a syncytine protein such as Syncytin -1 / (DOI: 10.1128 / JVI.76.13.6442-6452.2002) and Syncytin-2, myomaker - (biorxiv.org/content/early/2017/04/02/123158, —doi.org/
[00649] [00649] In some embodiments, the fusosome comprises a curvature-generating protein, for example, Epsin 1, dinamine or a protein comprising a BAR domain. See, for example, Kozlovet al, CurrOp StrucBio 2015, Zimmerberget al. Nat Rev 2006, Richard et al., Biochem J 2011. NON-MAMMALIAN PROTEINS VIRAL PROTEINS
[00650] [00650] In some embodiments, fusogen may include a non-mammalian protein, for example, a viral protein. In some embodiments, a viral fusogen is a Class | viral membrane fusion protein, a Class II viral membrane protein, a Class III viral membrane fusion protein, a viral membrane glycoprotein or other viral fusion proteins, or a homologue thereof, a fragment thereof, a variant thereof or a protein fusion comprising one or more proteins or fragments thereof.
[00651] [00651] In some embodiments, Class I viral membrane fusion proteins | include, but are not limited to, Baculovirus F protein, for example, F proteins of the genus nucleopolyhedrovirus (NPV), for example, Spodoptera require MNPV (SeMNPV), protein F and Lymantria dispar MNPV (LAMNPV) and F proteins of paramyxovirus.
[00652] [00652] In some embodiments, Class I viral membrane proteins | include, but are not limited to, tick bone encephalitis E (TBEV E), Semliki E1 / E2 Forest Virus.
[00653] [00653] In some embodiments, Class III viral membrane fusion proteins include, but are not limited to, rhabdovirus G (e.g., vesicular stomatological virus (VSV-G) fusogenic protein G), glycoprotein Herpesvirus B (for example, Herpes Simplex virus 1 (HSV-1) gB)), Epstein Barr virus glycoprotein B (EBV gB), thogotovirus G, baculovirus gp64 (for example, Autographa California multiple NPV (ACMNPV) gp64) and glycoprotein of the Borna disease virus (BDV) (BDV G).
[00654] [00654] “Examples of other viral fusogens, for example, membrane glycoproteins and viral fusion proteins, include, but are not limited to: viral syncytial proteins such as influenza hemagglutinin (HA) or mutants, or fusion thereof; human immunodeficiency virus type 1 (HIV-1 ENV) envelope protein, HIV-binding LFA-1 gp120 to form lymphocyte syncytia, HIV gp41, HIV gp160 or HIV Transcription Transactivator (TAT) ; viral glycoprotein VSV-G, viral glycoprotein of the vesicular stomatitis virus of the family Rhabdoviridae; varicella-zoster virus (VZV) gB and gH-GL glycoproteins; murine leukemia virus (MLV) - 10A1; Gibbon monkey leukemia virus glycoprotein (GaLV); rabies type G glycoproteins, Mokola, vesicular stomatitis virus and Togavirus; murine hepatitis virus JHM surface projection protein; ear glycoproteins and porcine coronavirus membrane; avian infectious bronchitis increases glycoprotein and its precursor; bovine enteric coronavirus peak protein; the measles virus F and H, HN or G genes; canine distemper virus, Newcastle disease virus, human parainfluenza virus 3, simian virus 41, Sendai virus and human respiratory syncytial virus; gH of human herpesvirus 1 and simian varicella virus, with the chaperone protein gL; human, bovine and cercopiticino gB herpesviruses; envelope glycoproteins from the Friend murine leukemia virus and the Mason Pfizer virus; mumps virus, hemagglutinin neuraminidase and glycoproteins F1 and F2; Venezuelan equine encephalomyelitis membrane glycoproteins; paramyxovirus F protein; SIV protein gp160; Protein G from the Ebola virus; or Sendai virus fusion protein, or a homologue thereof, a fragment thereof, a variant thereof and a protein fusion comprising one or more proteins or fragments thereof.
[00655] [00655] - “Non-mammalian fusogens include viral fusogens, their counterparts, their fragments and fusion proteins comprising one or more proteins or fragments thereof. Viral fusogens include class | fusogen, class II fusogen, class Ill fusogen and class IV fusogen.
[00656] [00656] In some modalities, fusogen is a paramyxovirus fusogen. In some embodiments, fusogen is an Nipah virus F protein, a measles virus F protein, a paramixovirus tupaia F protein, a paramixovirus F protein, a Hendra virus F protein, a Henipavirus F protein, a Morbilivirus F protein, a respirovirus F protein, a Sendai virus F protein, a rubulavirus F protein or an avulavirus F protein.
[00657] [00657] In some embodiments, fusogen is a fusogen of poxviridae.
[00658] [00658] “Additional exemplary fusogens are disclosed in the US
[00659] [00659] In some embodiments, fusogen may include a pH-dependent protein (for example, as in cases of ischemic injury), its homolog, a fragment thereof and a fusion of proteins comprising one or more proteins or fragments thereof . Fusogens can mediate the fusion of the membrane on the cell surface or on an endosome or in another space attached to the cell membrane.
[00660] [00660] In some embodiments, fusogen includes a gap junction protein EFF-1, AFF-1, for example, a connexin (such as Cn43, GAP43, CX43) (DOI: 10.1021 / jacs.6b05191), other proteins tumor connection, a homologue thereof, a fragment thereof, a variant thereof and a fusion of proteins comprising one or more proteins or fragments thereof. MODIFICATIONS IN PROTEIN FUSOGEN
[00661] [00661] —Protein fusogens can be reoriented by mutating amino acid residues into a fusion protein or a targeting protein (for example, the hemagglutinin protein). In some embodiments, fusogen is mutated at random. In some embodiments, fusogen is rationally mutated. In some modalities, fusogen is subject to targeted evolution. In some embodiments, fusogen is truncated and only a subset of the peptide is used in the fusosome. For example, amino acid residues in the measles hemagglutinin protein can be mutated to alter the binding properties of the protein, redirecting fusion (doi: 10.1038 / nbt942, Molecular Therapy vol. 16 no 8, 1427 to 1436 August 2008, doi: 10.1038 / nbt1060, DOI: 10.1128 / JV | .76.7.3558—-3563.2002, DOI: 10.1128 / JVI.75.17.8016-8020.2001, doi: 10.1073pnas.0604993103).
[00662] [00662] “Protein fusogens can be reoriented by covalently conjugating a chemical targeting portion to the fusion protein or targeting protein (for example, the hemagglutinin protein). In some embodiments, the fusogen and the targeting chemical moiety are covalently conjugated by the expression of a chimeric protein comprising the fusogen attached to the targeting moiety. A target includes any peptide (for example, a receptor) that is displayed in a target cell. In some examples, the target is expressed at higher levels in a target cell than in non-target cells. For example, the single-stranded variable fragment (scFv) can be conjugated to fusogens to redirect fusion activity to cells that display the scFv binding target (doi: 10.1038 / nbt1060, DOI 10.1182 / blood-2012-11 -468579, doi:
[00663] [00663] A target portion can comprise, for example, a humanized antibody molecule, intact IgA, IgG, IgE or IgM; bi or multi-specific antibody (eg, Zybodies &, etc.); antibody fragments, such as Fab fragments, Fab 'fragments, F (ab') 2 fragments, Fd 'fragments, Fd fragments and CDRs or isolated sets; Single chain Fvs; polypeptide-Fc fusions; single domain antibodies (for example, shark single domain antibodies, such as lg-NAR or fragments thereof); cameloid antibodies; masked antibodies (for example, Probodies &); Small modular immunopharmaceuticals ("SMIPSTM"); single-chain or tandem diabetes (TandAbO); VHHs; AnticalinsO; NanobodiesO; minibodies; BITEOs; ankyrin or DARPINsSO repeat proteins; AvimersO; Darts; TCR-like antibodies ;, AdnectinsO; Affilins &;Trans-bodiesO; Affibodies &;TrimerXO;MicroProteins; FynomersO, CentyrinsO; and KALBITORO.
[00664] [00664] In the modalities, the redirected fusogen binds a cell surface marker in the target cell, for example, a protein, glycoprotein, receptor, cell surface ligand, agonist, lipid, sugar, transmembrane protein class |, transmembrane protein class | or class III transmembrane protein.
[00665] [00665] Fusosomes can exhibit targeting chemical portions that are not conjugated to protein fusogens, in order to redirect fusion activity towards a cell that is bound by the targeting chemical portion or affect the return to the fusosome.
[00666] [00666] The chemical targeting portion added to the sump spindles can be modulated to have different binding forces. For example, scFvs and antibodies with various binding forces can be used to alter the fusosome's fusion activity towards cells that exhibit high or low amounts of the target antigen (doi:
[00667] [00667] In some modalities, protein fusogens can be altered to reduce immunoreactivity. For example, protein fusogens can be decorated with molecules that reduce immunological interactions, such as PEG (DOI: 10.1128 / JVI.78.2. 912-921.2004). Thus, in some embodiments, fusogen comprises PEG, for example, it is a PEGylated polypeptide. Amino acid residues in fusogen that are guided by the immune system can be changed to not be recognized by the immune system (DOI: 10.1016 / j.virol.2014.01.027, doi: 10.1371 / journal. Pone.0046667). In some embodiments, the fusogen protein sequence is altered to resemble the amino acid sequences found in humans (humanized). In some modalities, the fusogen protein sequence is changed to a protein sequence that binds less strongly to MHC complexes. In some embodiments, protein fusogens are derived from viruses or organisms that do not infect humans (and against which humans have not been vaccinated), increasing the likelihood that a patient's immune system will be a virgin to protein fusogens (for example, there is an insignificant humoral or cell-mediated adaptive immune response against fusogen) (doi:
[00668] [00668] In some embodiments, the fusosome can be treated with fusogenic lipids, such as saturated fatty acids. In some embodiments, saturated fatty acids have between 10 and 14 carbons. In some embodiments, saturated fatty acids have longer chain carboxylic acids. In some embodiments, saturated fatty acids are monoesters.
[00669] [00669] In some embodiments, the fusosome can be treated with unsaturated fatty acids. In some embodiments, unsaturated fatty acids have between C16 and C18 fatty acids. In some embodiments, unsaturated fatty acids include oleic acid, glycerol monooleate, glycerides, diacylglycerol, modified unsaturated fatty acids and any combination thereof.
[00670] [00670] Without wishing to be limited by theory, in some modalities, lipids of negative curvature promote the fusion of the membrane. In some embodiments, the fusosome comprises one or more lipids of negative curvature, for example, lipids of exogenous negative curvature, in the membrane. In modalities, the negative curvature lipid or a precursor of it is added to the medium that comprises cells of origin or fusosomes. In the modalities, the cell of origin is designed to express or overexpress one or more genes of lipid synthesis. The negative curvature lipid can be, for example, diacylglycerol (DAG), cholesterol, phosphatidic acid (PA), phosphatide
[00671] [00671] Without wanting to be limited by theory, in some modalities, lipids with positive curvature inhibit membrane fusion. In some embodiments, the fusosome comprises reduced levels of one or more lipids of positive curvature, for example, lipids of exogenous positive curvature, in the membrane. In the modalities, the levels are reduced by inhibiting lipid synthesis, for example, by naming or inactivating a lipid synthesis gene, in the source cell. The positive curvature lipid can be, for example, lysophosphatidylcholine (LPC), phosphatidylinositol (Ptdlns), lysophosphatidic acid (LPA), lyso-phosphatidylethanolamine (LPE) or monoacylglycerol (MAG). CHEMICAL FUSOGEN
[00672] [00672] In some embodiments, the fusosome can be treated with fusogenic chemicals. In some modalities, the fusogenic chemical product is polyethylene glycol (PEG) or its derivatives.
[00673] [00673] In some modalities, chemical fusogen induces a local dehydration between the two membranes that leads to unfavorable molecular packaging of the bilayer. In some modalities, chemical fusogen induces the dehydration of an area close to the lipid bilayer, causing displacement of aqueous molecules between the cells and allowing the interaction between the two membranes together.
[00674] [00674] In some embodiments, chemical fusogen is a positive cation. Some non-limiting examples of positive cations include Ca *, Mg *, Mn *, Zn *, La **, Sr ** and H *.
[00675] [00675] In some modalities, the chemical fusogen binds to the target membrane, changing the polarity of the surface, which alters the intermembrane repulsion dependent on hydration.
[00676] [00676] In some embodiments, chemical fusogen is a soluble lipid. Some non-limiting examples include oleoylglycerol, diole-
[00677] [00677] In some modalities, chemical fusogen is a water-soluble chemical product. Some non-limiting examples include polyethylene glycol, dimethyl sulfoxide and variants and derivatives thereof.
[00678] [00678] In some modalities, chemical fusogen is a small organic molecule. A non-limiting example includes n-hexyl bromide.
[00679] [00679] In some embodiments, the chemical fusogen does not alter the constitution, cell viability or ion transport properties of the fusogen or the target membrane.
[00680] [00680] In some modalities, chemical fusogen is a hormone or a vitamin. Some non-limiting examples include abscisic acid, retinol (vitamin A1), a tocopherol (vitamin E) and its variants and derivatives.
[00681] [00681] In some embodiments, the fusosome comprises actin and an agent that stabilizes polymerized actin. Without wishing to be | imitated by theory, actin stabilized in a fusosome can promote fusion with a target cell. In the embodiments, the agent that stabilizes the polymerized actin is chosen from actin, myosin, biotin-streptavidin, ATP, Wiskott-Aldrich neuronal syndrome protein (N-WASP) or formalin. See, for example, Langmuir. August 16, 2011; 27 (16): 10061 to 10071 and Wen et al., Nat Commun. August 31, 2016; 7. In modalities, the fusosome comprises exogenous actin, for example, wild-type actin or actin comprising a mutation that promotes polymerization. In modalities, the fusosome comprises ATP or phosphocreatine, for example, exogenous ATP or phosphocreatine. SMALL MOLECULE FUSOGEN
[00682] [00682] In some embodiments, the fusosome can be treated with small fusogenic molecules. Some non-limiting examples
[00683] [00683] In some modalities, small molecule fusogen may be present in aggregates similar to micelles or free of aggregates. FUSOGEN MODIFICATIONS
[00684] [00684] In some embodiments, fusogen is linked to a cleavable protein. In some cases, a cleavable protein can be cleaved by exposure to a protease. A engineered fusion protein can bind any domain of a transmembrane protein. The engineered fusion protein can be linked by a cleavage peptide to a protein domain located within the inter-membrane space. The cleavage peptide can be cleaved by one or a combination of intermembrane proteases (for example, HTRA2 / OMI that requires a non-polar aliphatic amino acid - valine, isoleucine or methionine are preferred - in the P1 position, and hydrophilic residues - arginine are preferred - in positions P2 and P3).
[00685] [00685] In some embodiments, fusogen is linked to an affinity tag. In some embodiments, the affinity tag assists in the separation and isolation of fusosomes. In some ways, the affinity tag is cleavable. In some embodiments, the affinity tag is not covalently linked to fusogen. In some embodiments, the affinity tag is present on the fusosome and separated from the fusogen.
[00686] [00686] In some embodiments, fusogenic proteins are manipulated by any methods known in the art or by any method described here to understand a proteolytic degradation sequence, for example, a mitochondrial or cytosolic degradation sequence . Fusogenic proteins can be designed to include, but are not limited to, a pro-
[00687] [00687] In some embodiments, fusogen can be modified with a protease domain that recognizes specific proteins, for example, overexpression of a protease, for example, a fusion protein manipulated with protease activity. For example, a protease or protease domain of a protease, such as MMP, mitochondrial processing peptidase, mitochondrial intermediate peptidase, inner membrane peptidase.
[00688] [00688] See Alfonzo, JD & Soll, D. Mitochondrial tRNA import - the challenge to understand has just begun. Biological Chemistry 390: 717 to 722. 2009; Langer, T. et al. Characterization of Peptides Released from Mitochondria. THE JOURNAL OF BIOLOGICAL CHEMISTRY. 280, n. 4. 2691 to 2699, 2005; Vliegh, P. et al. Synthetic therapeutical peptides: science and market. Drug Discovery Today. 15 (1/2). 2010; Quiros PMm et al., New roles for mitochondrial proteases in health, aging and disease. Nature Reviews Molecular Cell Biology. V16, 2015; Weber-Lotfi, F. et al. DNA import competence and mythochondrial genetics. Biopolymers and Cell. Vol. 30. N 1.71 to 73, 2014. FUSOSOME GENERATION FUSOSOMES GENERATED FROM CELLS
[00689] [00689] Fusosome compositions can be generated from cultured cells, for example cultured mammalian cells, for example, cultured human cells. The cells can be parental cells or non-progenitor cells (for example, differentiated). The cells can be primary cells or cell lines (for example, a mammalian, for example, human cell line, described herein). In the modalities, the cultured cells are parental cells, for example, bone marrow stromal cells, marrow derived adult parental cells (MAPCs), parental endothelial cells (EPC), blast cells, blast cells, intermediate parental cells formed in the subventricular zone, neural stem cells, muscle stem cells, satellite cells, liver stem cells, hematopoietic stem cells, bone marrow stromal cells, epidermal stem cells, embryonic stem cells, mesenchymal stem cells, cells - umbilical cord stem, precursor cells, muscle precursor cells, myoblasts, cardiomyoblasts, neural precursor cells, glial precursor cells, neuronal precursor cells, hepatoblasts.
[00690] [00690] In some embodiments, the source cell is an endothelial cell, a fibroblast, a blood cell (for example, a macrophage, a neutrophil, a granulocyte, a leukocyte), a cell
[00691] [00691] The cultured cells can be tissue or epithelial, connective, muscle or nerve cells, and combinations of the same. The fusosome can be generated from cells cultured from any system of eukaryotic organs (for example, mammals), for example, from the cardiovascular system (heart, vasculature); digestive system (esophagus, stomach, liver, gallbladder, pancreas, intestine, colon, rectum and anus); endocrine system (hypothalamus, pituitary, pineal body or pineal gland, thyroid, parathyroid, adrenal glands); excretory system (kidneys, ureters, bladder); lymphatic system (lymph, lymph nodes, lymphatic vessels, tonsils, adenoids, thymus, spleen); integumentary system (skin, hair, nails); muscu-
[00692] [00692] In some modalities, the cells are from a young donor, for example, a donor of 25 years, 20 years, 18 years, 16 years, 12 years, 10 years, 8 years old, 5 years old, 1 year old or less. In some embodiments, the cells are of fetal tissue.
[00693] [00693] In some embodiments, the cells are derived from a subject and administered to the same subject or to a subject with a similar genetic signature (for example, compatible with MHC).
[00694] [00694] In certain modalities, cells have medium-sized telomeres greater than 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 nucleotides in length (for example, between 4,000 and
[00695] [00695] Fusosomes can be generated from cells generally cultured according to methods known in the art. In some embodiments, cells can be grown in 2 or more "stages", for example, a growth phase, in which cells are grown under conditions to multiply and increase the biomass of the culture and a " production ", in which cells are grown under conditions to alter the cell phenotype (e.g.,
[00696] [00696] In some embodiments, fusosomes are generated from synchronized cells, for example, during a growth phase or the production phase. For example, cells can be synchronized in the G1 phase by eliminating serum from the culture medium (for example, for about 12 to 24 hours) or by using DNA synthesis inhibitors in the culture medium, such as thymidine, aminopterin, hydroxyurea and cytosine arabinoside. Additional methods for synchronizing the mammalian cell cycle are known and disclosed, for example, in Rosner et al. 2013. Nature Protocols 8: 602 to 626 (specifically Table 1 in Rosner).
[00697] [00697] In some embodiments, cells can be evaluated and optionally enriched for a desirable phenotype or genotype for use as a source of fusosome composition, as described here. For example, cells can be evaluated and optionally enriched, for example, before culture, during culture (for example, during a growth phase or a production phase) or after culture, but before the production of fusosomes, by example, for one or more of the following: membrane potential (for example, a membrane potential of -5 to -200 mV; cardiolipin content (for example, between 1 and 20% of the total lipid); cholesterol, phosphatidylethanolamine (PE), diglyceride (DAG), phosphatidic acid (PA) or fatty acid (FA) content; genetic quality> 80%,> 85%,> 90%; fusogen expression or content; expression or content of the charge.
[00698] [00698] In some embodiments, fusosomes are generated from an identified cell clone, chosen or selected based on a desirable phenotype or genotype for use as a source of fusosome composition described here. For example, a cell clone is identified, chosen, or selected based on low mitochondrial mutation load, long telomere length, state of differentiation, or a specific genetic signature (for example, a genetic signature to match a recipient) .
[00699] [00699] A fusosome composition described herein can be composed of fusosomes from a cell or tissue source or a combination of sources. For example, a spindle-sum composition may comprise fusosomes from xenogenic sources (eg animals, tissue culture from cells of the species mentioned), allogeneic, autologous, from specific tissues, resulting in different concentrations and distributions of proteins ( liver, skeletal, neural, adipose, etc.), cells of different metabolic states (eg glycolytic, respiratory). A composition can also comprise fusosomes in different metabolic states, for example, coupled or uncoupled, as described elsewhere in this document.
[00700] [00700] In some embodiments, fusosomes are generated from cells of origin that express a fusogen, for example, a fusogen described here. In some embodiments, the fusogen is arranged on a membrane of the cell of origin, for example, a lipid bilayer membrane, for example, a membrane of the cell surface or a subcellular membrane (for example, lysosomal membrane). In some embodiments, fusosomes are generated from cells of origin with a fusogen arranged in a cell surface membrane.
[00701] [00701] In some embodiments, fusosomes are generated by the induction of budding of an exosome, microvesicle, membrane vesicle, extracellular membrane vesicle, plasma membrane vesicle, giant plasma membrane vesicle, apoptotic body, mitoparticle, pyrococyte, lysosome or other vesicle surrounded by membrane.
[00702] [00702] In some embodiments, the production of fusosomes comprises the positive regulation of the expression of a protein that is heterologous or endogenous to the cell of origin. In some modalities, the protein positively regulates the release of fusosomes from the plasma membrane. In some embodiments, the protein is a structural viral protein, for example, viral Gag protein, matrix protein, capsid protein or nucleocapsid protein. In some embodiments, the protein is a late viral protein. In some modalities, the protein is a protein encoded by the human genome. In some embodiments, the protein involves the ESCRT pathway. In some modalities, the protein contracts ESCRT-1. In some modalities, the protein involves Tsg101. In some embodiments, the protein is incorporated into the fusosomes. In some embodiments, the protein is not incorporated into the fusosomes. In some embodiments, the protein is an arrestin. In some embodiments, the protein is AR-RDC1. In some embodiments, TSG101 is present at higher levels in fusosomes than in parental cells or exosomes. In some embodiments, the level of TSG101 as a percentage of the total protein content is at least about 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006% or 0.007% in fusosomes. In some embodiments, ARRDC1 is present at higher levels in fusosomes than in parental cells or exosomes. In some embodiments, the level of ARRDC1 as a percentage of the total protein content will be at least about 0.01%, 0.02%, 0.03%, 0.04% or 0.05% in fusosomes . In some embodiments, the protein contains a PSAP. PTAP, PPxY or YPxL motif that recruits ubiquitin ligases from the ESCRT-1, Nedda4 family, such as WWP 2 or Alix. For example, these proteins are described in US9737480B2, Scourfied and Martin-Serrano, Biochemical Society Transactions 2017, Zhadina and Bieniasz, PLoS Pathogens 2010, all incorporated by reference.
[00703] [00703] In some embodiments, fusosomes are generated by inducing cell enucleation. Enucleation can be performed using assays such as genetic, chemical (for example, using Actinomyncin D, see Bayona-Bafaluyet al., "A chemical enucleation method for the transfer of mitochondrial DNA to pº cells" Nucleic Acids Res. August 15 2003; 31 (16): e98), mechanical methods (for example, compression or aspiration, see Lee et al., "A comparative study on the efficiency of two enucleation methods in the nuclear transfer of somatic cells from swine: effects of compression and aspiration methods ". Anim Biotechnol. 2008; 19 (2): 71 to 79), or combinations thereof. Enucleation refers not only to the complete removal of the nucleus, but also to the displacement of the nucleus from its typical location, so that the cell contains the nucleus, but is not functional.
[00704] [00704] In modalities, making a fusosome comprises producing ghosts of cells, giant plasma membrane vesicles, or apoptotic bodies. In the modalities, a spindle-sum composition comprises one or more cellular phantoms, a giant vesicle of the plasma membrane and apoptotic bodies.
[00705] [00705] In some embodiments, fusosomes are generated by inducing cell fragmentation. In some embodiments, cell fragmentation can be performed using the following methods, including, but not limited to: chemical methods, mechanical methods (eg, centrifugation (eg, ultracentrifugation or density centrifugation), freezing- thawing or soot) or combinations thereof.
[00706] [00706] In one embodiment, a fusosome can be generated from a cell of origin that expresses a fusogen, for example, as described here, by anyone, all or a combination of the following methods: i) induce the budding of a mitoparticle, exosome or other vesicle wrapped in a membrane; ii), induce nuclear inactivation, for example, enucleation, by any of the following methods or a combination thereof: a) a genetic method; b) a chemical method, for example, using Actinomycin D; or c) a mechanical method, for example, compression or aspiration; or iii) induce cell fragmentation, for example, by any of the following methods or a combination thereof: a) a chemical method; b) a mechanical method, for example, centrifugation (for example, ultracentrifugation or density centrifugation); freeze thaw; or sonication.
[00707] [00707] For the avoidance of doubt, it is understood that, in many cases, the original cell actually used to manufacture the fusosome will not be available for testing after the manufacture of the fusosome. Thus, a comparison between a source cell and a fusosome does not need to analyze the source cell that was actually modified (for example, enucleated) to create the fusosome. Instead, cells otherwise similar to the source cell, for example, from the same culture, the same genotype, the same type of tissue or any combination
[00708] [00708] In one aspect, a modification is made in a cell, as a modification of a subject, tissue or cell, before the generation of the fusosome. Such modifications can be effective, for example, to improve the fusion, expression or activity of fusogen, structure or function of the charge, or structure or function of the target cell. PHYSICAL MODIFICATIONS
[00709] [00709] In some embodiments, a cell is physically modified before the generation of the fusosome. For example, as described elsewhere in this document, a fusogen can be attached to the cell's surface.
[00710] [00710] In some embodiments, a cell is treated with a chemical agent before the generation of the fusosome. For example, the cell can be treated with a chemical or lipid fusogen, so that the chemical or lipid fusogen does not covalently or covalently interact with the cell surface or incorporate within the cell surface. In some embodiments, the cell is treated with an agent to improve the fusogenic properties of lipids on the cell membrane.
[00711] [00711] In some embodiments, the cell is physically modified before generating the fusosome with one or more binding or non-covalent binding sites for small molecules or synthetic or endogenous lipids on the cell surface that enhance targeting fusosome to an organ, tissue or cell type.
[00712] [00712] In the modalities, a fusosome comprises increased or decreased levels of an endogenous molecule. For example, the fusosome may comprise an endogenous molecule that also occurs naturally in the cell of natural origin, but at a higher or lower level than in the fusosome. In some modalities, the polypeptide is expressed from an exogenous nucleic acid in the source cell or in the fusosome. In some embodiments, the polypeptide is isolated from a source and loaded or conjugated to a cell of origin or fusosome.
[00713] [00713] In some embodiments, a cell is treated with a chemical agent before generating the fusosome to increase the expression or activity of an endogenous fusogen in the cell. In a fashion, the small molecule may increase the expression or activity of an endogenous fusogen transcription activator. In another mode, the small molecule may decrease the expression or activity of an endogenous fusogen transcription repressor. In yet another embodiment, the small molecule is an epigenetic modifier that increases the expression of endogenous fusogen.
[00714] [00714] In some embodiments, fusosomes are generated from cells treated with antiparasitic compounds, for example, lysophosphatidylcholine. In some embodiments, fusosomes are generated from cells treated with dissociation reagents that do not cleave fusogens, for example, Accutase.
[00715] [00715] In some modalities, the cell is physically modified with, for example, CRISPR activators, before generating the spindle sum to add or increase the concentration of fusogens.
[00716] [00716] In some modalities, the cell is physically modified to increase or decrease the amount or improve the structure or function of the organelles, for example, mitochondria, Golgi complex, endoplasmic reticulum, intracellular vesicles (such as lysosomes, autophagosomes). GENETIC MODIFICATIONS
[00717] [00717] In some modalities, a cell is genetically modified before the generation of the fusosome to increase expression
[00718] [00718] In some modalities, a cell is genetically modified before the generation of the fusosome to increase the expression of an exogenous fusogen in the cell, for example, delivery of a transgene. In some embodiments, a nucleic acid, for example, DNA, mRNA or siRNA, is transferred to the cell before the generation of the fusosome, for example, to increase or decrease the expression of a cell surface molecule (protein, glycan, lipid or low molecular weight molecule) used to target organs, tissues or cells. In some embodiments, the nucleic acid targets a fusogen repressor, for example, a shRNA, SIiRNA construct. In some embodiments, the nucleic acid encodes a fusogen repressor inhibitor.
[00719] [00719] In some modalities, the method comprises the introduction of an exogenous nucleic acid that encodes a fusogen in the cell of origin. The exogenous nucleic acid can be, for example, DNA or RNA. In some embodiments, exogenous DNA can be linear DNA, circular DNA or an artificial chromosome. In some embodiments, DNA is maintained episomally. In some modalities, DNA is integrated into the genome. The exogenous RNA can be chemically modified RNA, for example, it can comprise one or more major structure modifications, sugar modifications, non-canonical bases or caps. Modifications of the spine include, for example, phosphorothioate, phosphoramidite N3 ', boranophosphate, phosphonoacetate, thio-PACE, morpholino phosphoramidites or PNA. Sugar modifications include, for example, 2'-O-Me, 2'F, 2 "F-ANA, LNA, UNA and 2'iO-MOE. Non-canonical bases include, for example, 5-bromo- U and 5-iodo-U, 2,6-diaminopurine, C-5 propynylpyrimidine, difluoro-toluene, difluorobenzene, dichlorobenzene, 2-thiouridine, pseudouridine and dihydrouridine. Caps include, for example, ARCA. Additional modifications are discussed , for example, in Deleavey et al., "Designing Chemically Modified Oligonucleotides for Targeted Gene Silencing" Chemistry & Biology Volume 19, Issue 8, August 24, 2012, pages 937 to 954, which is incorporated herein by reference in its totality.
[00720] [00720] In some embodiments, a cell is treated with a chemical agent before generating the fusosome to increase the expression or activity of an exogenous fusogen in the cell. In one embodiment, the small molecule can increase the expression or activity of an exogenous fusogen transcription activator. In another way, the small molecule can decrease the expression or activity of an exogenous fusogen transcriptional repressor. In yet another embodiment, the small molecule is an epigenetic modifier that increases the expression of exogenous fusogen.
[00721] [00721] In some embodiments, the nucleic acid encodes a modified fumogen. For example, a fusogen that has adjustable fusogenic activity, for example, specific activity of the cell type, tissue type or local microenvironment. This adjustable fusogenic activity may include, activation and / or initiation of fusogenic activity by low pH, high pH, heat, infrared light, extracellular enzymatic activity (eukaryotic or prokaryotic) or exposure of a small molecule, protein or protein. lipid. In some embodiments, the small molecule, protein or lipid is displayed in a target cell.
[00722] [00722] In some embodiments, a cell is genetically modified before generating the fusosome to alter (ie, regulate positively or positively) the expression of signaling pathways (for example, the Wnt / Beta-catenin pathway). In some embodiments, a cell is genetically modified before generating the fusosome to alter (for example, up or down regulation) the expression of a gene or genes of interest. In some embodiments, a cell is genetically modified before generating the fusosome to alter (for example, up or down regulation) the expression of a nucleic acid (for example, a miRNA or mRNA) or nucleic acids of interest. In some embodiments, nucleic acids, for example, DNA, mRNA or siRNA, are transferred to the cell before generating the fusosome, for example, to increase or decrease the expression of signaling pathways, genes or nucleic acids. In some embodiments, the nucleic acid targets a repressor of a signaling pathway, gene or nucleic acid, or represses a signaling pathway, gene or nucleic acid. In some embodiments, the nucleic acid encodes a transcription factor that either positively or negatively regulates a signaling pathway, gene or nucleic acid. In some embodiments, the activator or repressor is a nuclease-inactivated cas9 (dCas9) linked to a transcriptional activator or repressor that is directed to the signaling pathway, gene or nucleic acid by a guide RNA. In yet another modality, genetic modification epigenetically modifies an endogenous signaling pathway, gene or nucleic acid to its expression. In some modalities, the epi-
[00723] [00723] A cell can be genetically modified using recombinant methods. A nucleic acid sequence encoding a desired gene can be obtained using recombinant methods, such as, for example, searching libraries of cells that express the gene, deriving the gene from a vector known to include the same or directly isolating cells and tissues containing it, using standard techniques. Alternatively, a gene of interest can be produced synthetically, rather than cloned.
[00724] [00724] The expression of natural or synthetic nucleic acids is typically achieved by operationally binding a nucleic acid that encodes the gene of interest to a promoter and by incorporating the construct into an expression vector. The vectors may be suitable for replication and integration in eukaryotes. Typical cloning vectors contain transcription and translation terminators, initiation sequences and promoters useful for the expression of the desired nucleic acid sequence.
[00725] [00725] In some embodiments, a cell can be genetically modified with one or more expression regions, for example, a gene. In some embodiments, the cell can be genetically modified with an exogenous gene (for example, capable of expressing an exogenous genetic product, such as an RNA or a polypeptide product) and / or an exogenous regulatory nucleic acid. In some embodiments, the cell can be genetically modified with an exogenous sequence that encodes a gene product that is endogenous to a target cell and / or an exogenous regulatory nucleic acid capable of modulating the expression of an endogenous gene. In some modalities, the cell can be genetically modified with an exogenous gene and / or a regulatory nucleic acid that modulates the expression of an exogenous gene. In some embodiments, the cell can be genetically modified with an exogenous gene and / or a regulatory nucleic acid that modulates the expression of an endogenous gene. It will be understood by one skilled in the art that the cell described herein can be genetically modified to express a variety of exogenous genes that encode proteins or regulatory molecules, which can, for example, act on a genetic product of the endogenous or exogenous genome. of a target cell. In some embodiments, these genes give characteristics to the fusosome, for example, modulating fusion with a target cell. In some embodiments, the cell can be genetically modified to express an endogenous gene and / or regulatory nucleic acid. In some embodiments, the endogenous gene or regulatory nucleic acid modulates the expression of other endogenous genes. In some embodiments, the cell can be genetically modified to express an endogenous gene and / or regulatory nucleic acid that is expressed differently (for example, inducible, tissue specific, constitutively or at a higher or lower level) than a version of the endogenous gene and / or regulatory nucleic acid on other chromosomes.
[00726] [00726] The promoter elements, for example, intensifiers, regulate the frequency of the beginning of transcription. They are usually located in the region 30-110 bp upstream of the start site, although several promoters have recently been shown to contain functional elements downstream of the start site. The spacing between
[00727] [00727] An example of a suitable promoter is the cytomegalovirus (CMV) immediate promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked to it. Another example of a suitable promoter is the Stretch Growth Factor-1a (EF-1a0). However, other constitutive promoter sequences can also be used, including, among others, the initial promoter of simian virus 40 (SV40), the mouse mammary tumor virus (MMTV), the promoter of long repeat terminal (LTR) of the human immunodeficiency virus (HIV), MoMulV promoter, a promoter of the avian leukemia virus, an immediate early promoter of the Epstein-Barr virus, a promoter of the Rous sarcoma virus, as well as promoters of human genes - in us, as, among others, the actin promoter, the myosin promoter, the hemoglobin promoter and the creatine kinase promoter.
[00728] [00728] In addition, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of activating the expression of the polynucleotide sequence, which is operationally linked when such expression is desired, or disabling the expression when expression is not desired. Examples of inducible promoters include, but are not limited to, a tissue specific promoter, metallothionine promoter, glucocorticoid promoter, progesterone promoter and tetracycline promoter. In some embodiments, the expression of a fusogen is up-regulated before the generation of fusosomes, for example, 3, 6, 9, 12, 24, 26, 48, 60 or 72 hours before the generation of fusosomes.
[00729] [00729] The expression vector to be introduced into the source may also contain a selectable marker gene or a reporter gene or both to facilitate the identification and selection of cells expressing the population of cells seeking to be transfected or infected by viral vectors. In other respects, the selectable marker can be transported on a separate piece of DNA and used in a co-transfection procedure. Selectable markers and reporter genes can be flanked with appropriate regulatory sequences to allow expression in host cells. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.
[00730] [00730] Reporter genes can be used to identify potentially transfected cells and to assess the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present or expressed by the recipient source and that encodes a polypeptide whose expression is manifested by some easily detectable property, for example, enzymatic activity. The expression of the reporter gene is analyzed at an appropriate time after the introduction of DNA into the recipient cells. Suitable reporter genes can include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase or the green fluorescent protein gene (eg, Ui-Tei et al., 2000 FEBS Letters 479: 79 to 82 ). Suitable expression systems are well known and can be prepared using known or commercially obtained techniques. In general, the construct with the region flanked
[00731] [00731] In some embodiments, a cell can be genetically modified to alter the expression of one or more proteins. The expression of one or more proteins can be modified for a specific time, for example, state of development or differentiation of the source. In one embodiment, the invention includes fusosomes generated from a source of genetically modified cells to alter the expression of one or more proteins, for example, fusogenic proteins or non-fusogenic proteins that affect fusion activity, structure or function. The expression of one or more proteins can be restricted to a specific site or sites or disseminated throughout the source.
[00732] [00732] In some embodiments, the expression of a fusogenic protein is modified. In one embodiment, the invention includes spindosomes generated from cells with modified expression of a fusogenic protein, for example, an increase or decrease in the expression of a fusogen by at least 10%, 15%, 20%, 30% , 40%, 50%, 60%, 75%, 80%, 90% or more.
[00733] [00733] In some embodiments, cells can be modified to express a cytosolic enzyme (for example, proteases, phosphatases, kinases, demethylases, methyltransferases, acetylases) that targets a fusogenic protein. In some embodiments, the cytosolic enzyme affects one or more fusogens by altering post-translational modifications. Post-translational protein modifications of proteins can affect the responsiveness to the availability of nutrients and redox conditions, in addition to protein-protein interactions. In one embodiment, the invention includes a fusosome comprising fusogens with altered post-translational modifications, for example, an increase or decrease in post-translational modifications by at least 10%, 15%, 20%, 30%, 40%, 50 %, 60%, 75%, 80%, 90% or more.
[00734] [00734] Methods of introducing a modification into a cell include physical, biological and chemical methods. See, for example, Geng. & Lu, Microfluidic electroporation for cellular analysis and delivery. Lab on a Chip. 13 (19): 3803 to 3821. 2013; Sharei, A. et al. A vector-free microfluidic platform for intracellular delivery. PNAS vol. 110 no. 6. 2013; Yin, H. et al., Non-viral vectors for gene-based therapy. Nature Reviews Genetics. 15: 541 to 555. 2014. Suitable methods for modifying a cell for use in generating the fusosomes described here include, for example, diffusion, osmosis, osmotic pulse, osmotic shock, hypotonic lysis, hypotonic dialysis, ionophoresis, electroporation, sonication, microinjection, calcium precipitation, membrane interleaving, lipid-mediated transfection, detergent treatment, viral infection, receptor-mediated endocytosis, use of protein transduction domains, particle burning, fusion of membranes, defrost and thaw, mechanical interruption and filtration.
[00735] [00735] Confirming the presence of a genetic modification includes a variety of assays. Such assays include, for example, molecular biological tests, such as Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a specific peptide, for example, by immunological means (ELISA and Western blots) or by assays described herein. MODIFICATIONS IN MITOCHONDRIAL BIOGENESIS
[00736] [00736] In some embodiments, a method described here comprises: (a) providing a plurality of cells of origin that have been
[00737] [00737] In modalities, the modulator of mitochondrial biogenesis regulates positively or stimulates mitochondrial biogenesis. In other modalities, the modulator of mitochondrial biogenesis decreases or inhibits mitochondrial biogenesis.
[00738] [00738] In the modalities, the agent that modulates the amplification of mMtDNA is an agent that promotes or inhibits the amplification of mtDNA. In the embodiments, the agent that modulates mitochondrial lipid synthesis is an agent that promotes or inhibits mitochondrial lipid synthesis. In modalities, the agent that modulates the production of nuclear encoded mitochondrial proteins is an agent that promotes or inhibits the production of nuclear encoded mitochondrial proteins.
[00739] [00739] In the modalities, the agent that promotes the amplification of mMtDNA comprises: a protein that participates in the amplification of mMtDNA, a protein that positively regulates a protein that participates in the replication of mtDNA or a deoxyribonucleotide or precursor of it. In the modalities, the agent that promotes mitochondrial lipid synthesis is a lipid synthesis gene. In the modalities, the agent that promotes the production of mitochondrial proteins encoded in nuclear is a transcription factor.
[00740] [00740] In embodiments, the agent that inhibits mtDNA amplification comprises: an inhibitor of a protein that participates in mtDNA amplification (for example, a topoisomerase inhibitor,
[00741] [00741] In modalities, modulation of mitochondrial biogenesis comprises the modulation of a protein in Table 4. In modalities, modulation of mitochondrial biogenesis comprises modulating positive regulation, negative regulation, stimulation or inhibition of a gene. direct control (for example, a major regulator or DNA binding factor). In modalities, the modulation of mitochondrial biogenesis comprises positive regulation, negative regulation, stimulation or inhibition of a direct control gene in Table 4 (for example, a main regulator in Table 4 or a DNA binding factor in Table 4). In modalities, the modulation of mitochondrial biogenesis comprises positive regulation, negative regulation, stimulation or inhibition of an indirect control gene (for example, an activator or inhibitor). In modalities, modulation of mitochondrial biogenesis comprises positive regulation, negative regulation, stimulation or inhibition of an indirect control gene in Table 4 (for example, an activator in Table 4 or an inhibitor in Table 4). In modalities, the modulation of mitochondrial biogenesis comprises the positive or negative regulation of a metabolite, for example, a metabolite from Table 4.
[00742] [00742] In modalities, an agent that promotes or inhibits the synthesis of a mitochondrial lipid is capable of causing or results in an altered proportion of lipids in the mitochondrial membrane. In modalities, the agent that modulates the synthesis of a mitochondrial lipid result in an increase or decrease in the proportion of one of the following mitochondrial lipids: cardiolipin, phosphatidylglycerol, phosphatidylethanolamine, phosphatidic acid, CDP-diacylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylinositol, cholesterol, or ceramide, for example, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.
[00743] [00743] In some modalities, the method comprises providing one, two or all three of (i), (ii) and (iii). In some embodiments, the method comprises providing two of (i), (ii) and (iii), for example, (i) and (ii), (1) and (iii) or (ii) and ( iii). In some embodiments, the method comprises providing one of one, two or all three of (i), (ii) and (ii) at a level sufficient to stimulate mitochondrial biogenesis.
[00744] [00744] In modalities, the method comprises modular (for example, stimulating) mtDNA amplification (for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%). In the modalities, the modification of the mtDNA amplification occurs without detectable modulation (for example, stimulation) of one or both of the lipid synthesis and production of nuclear encoded mitochondrial proteins. In the modalities, the method comprises modulating (for example, stimulating) lipid synthesis (for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%) . In modalities, modulation occurs without detectable modulation (for example, stimulation) of one or both of mtDNA amplification and production of nuclear encoded mitochondrial proteins. In modalities, the method comprises modulating (for example, stimulating) the production of nuclear encoded mitochondrial proteins (for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%). In modalities, the modulating production of nuclear encoded mitochondrial proteins occurs without detectable modulation (for example, stimulation) of one or both of the lipid synthesis and amplification of mtDNA.
[00745] [00745] In the modalities, the method comprises modular (for example, stimulating) mtDNA amplification and lipid synthesis (for example, each independently by at least 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%). In modalities, the modulated amplification of mtDNA and lipid synthesis occurs without detectable modulation (for example, stimulation) of the production of nuclear encoded mitochondrial proteins. In the modalities, the method comprises modular (for example, stimulating) the amplification of mtDNA and the production of nuclear encoded mitochondrial proteins (for example, each independently by at least 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80% or 90%). In modalities, the modification of mtDNA amplification and the production of nuclear encoded mitochondrial proteins occur without detectable modulation (for example, stimulation) of lipid synthesis. In the modalities, the method comprises modular (for example, stimulating) lipid synthesis and the production of nuclear encoded mitochondrial proteins (for example, each independently by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%). In modalities, the modulating lipid synthesis and the production of nuclear encoded mitochondrial proteins occur without detectable modulation (for example, stimulation) of mtDNA amplification.
[00746] [00746] In the modalities, the method comprises modular (for example, stimulating) mtDNA amplification, lipid synthesis and the production of nuclear encoded mitochondrial proteins (for example, each independently by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%).
[00747] [00747] In the modalities, the modulator of mitochondrial biogenesis is a stimulator of mitochondrial biogenesis. In the modalities, the mitochondrial biogenesis modulator is a darkening stimulator. In the modalities, the darkening stimulator is PGC1a. In the modalities, the darkening stimulator is quinone, FGF21, irisin, apelin or isoproterenol. In embodiments, the plurality of cells of origin or a fusosome composition derived from the plurality of cells of origin is evaluated for darkening, for example, by ELISA for expression of UCP1, for example, as described in Spaethling et al. "Single-cell transcriptomics and functional target validation of brown adipocytes show their complex roles in metabolic homeostasis" ”. In: FASEB Journal, vol. 30, Edition 1, pp. 81 to 92, 2016.
[00748] [00748] In modalities, the plurality of cells of origin or a fusosome composition derived from the plurality is evaluated for the presence or level of mtDNA amplification, mitochondrial lipid synthesis or production of nuclear-encoded mitochondrial proteins or any combination thereof.
[00749] [00749] The source cell can be brought into contact with a modulator of mitochondrial biogenesis in an amount and for a time sufficient to increase mitochondrial biogenesis in the source cell (for example, by at least 10%, 15%, 20% , 30%, 40%, 50%, 60%, 75%, 80%, 90% or more). This modulator of mitochondrial biogenesis is described, for example, in Cameron et al. 2016. Must- lopment of Therapeutics That Induce Mitochondrial Biogenesis for the Treatment of Acute and Chronic Degenerative Diseases. DOI: 10.1021 / acs.jmnedchem.6b00669. In the modalities, the mitochondrial biogenesis modulator is added to the cell culture of origin during the growth phase and / or during the production phase. In the modalities, the mitochondrial biogenesis modulator is added when the cell culture of origin has a predetermined target density.
[00750] [00750] In one embodiment, the modulator of mitochondrial biogenesis is an agent extracted from a natural product or its synthetic equivalent, sufficient to increase mitochondrial biogenesis in the source cell. Examples of such agents include resveratrol, epicatechin, curcumin, a phytoestrogen (for example, genistein, daidzein, pyrroloquinoline, quinone, coumestro | and equol).
[00751] [00751] In another modality, the modulator of mitochondrial biogenesis is a sufficient metabolite to increase mitochondrial biogenesis in the source cell, mitochondria in the source cell, for example, a primary or secondary metabolite. These metabolites, for example, primary metabolites include alcohols such as ethanol, lactic acid, and certain amino acids and secondary metabolites include organic compounds produced through the modification of a major metabolite, are described in "Primary and Secondary Metabolites" . Boundless Microbiology. Boundless, May 26, 2016.
[00752] [00752] In one embodiment, the mitochondrial biogenesis modulator is a sufficient source of energy to increase mitochondrial biogenesis in the source cell, or mitochondria in the source cell, for example, sugars, ATP, redox cofactors like NADH and FADH 2. Such energy sources, for example, pyruvate or palmitate, are described in Mehlman, M. Energy Metabolism and the Regulation of Metabolic Processes in Mitochondria; Academic Press, 1972.
[00753] [00753] In one embodiment, the modulator of mitochondrial biogenesis is a modulator of the transcription factor sufficient to increase mitochondrial biogenesis in the source cell. Examples of such transcription factor modulators include: thiazolidinediones (eg, rosiglitazone, pioglitazone, troglitazone and ciglitazone), estrogens (eg, 17B-estradiol, progesterone) and estrogen receptor agonists; SIRT1 activators (for example, SRT1720, SRT1460, SRT2183, SRT2104).
[00754] [00754] In one embodiment, the modulator of mitochondrial biogenesis is a kinase modulator sufficient to increase mitochondrial biogenesis in the source cell. Examples include: AMPK and AMPK activators, such as AICAR, metformin, phenformin, A769662; and ERK1 / 2 inhibitors, such as U0126, trametinib.
[00755] [00755] In one embodiment, the modulator of mitochondrial biogenesis is a cyclic nucleotide modulator sufficient to increase mitochondrial biogenesis in the source cell. Examples include modulators of the NO-CGMP-PKG pathway (eg, nitric oxide (NO) donors, such as sodium nitroprusside, (t) S-nitrous-N-acetylpenylcylamine (SNAP), diethylamine NONOate (DEA- NONOate), diethylene triamine- NONOate (DETA-NONOate); SGC stimulators and activators, such as cinaciguat, riociguat and BAY 41-2272; and phosphodiesterase (PDE) inhibitors, such as zaprinast, sildena fi |, udena fi | , tadala fil and vardena fi |) and CAMP PKA-CREB Axis modulators, such as phosphodiesterase (PDE) inhibitors, such as rolipram.
[00756] [00756] In one embodiment, the modulator of mitochondrial biogenesis is a modulator of a receptor coupled to the G protein (GPCR), like a GPCR ligand, sufficient to increase the mitochondrial biogenesis in the source cell.
[00757] [00757] In one embodiment, the modulator of mitochondrial biogenesis is a modulator of a cannabinoid-1 receptor sufficient to increase mitochondrial biogenesis in the source cell. Examples include taranabant and rimonobant.
[00758] [00758] In one embodiment, the modulator of mitochondrial biogenesis is a modulator of a 5-hydroxytryptamine receptor sufficient to increase mitochondrial biogenesis in the source cell. Examples include alpha-methyl-5-hydroxytryptamine, DOI, CP809101, SB242084, serotonin reuptake inhibitors such as fluoxetine, alpha-methyl 5SHT, 1- (2,5-dimethoxy-4-iodophenyl) -2-aminopropane, LY334370 and LY344864.
[00759] [00759] In one embodiment, the modulator of mitochondrial biogenesis is a modulator of a beta-adrenergic receptor sufficient to increase mitochondrial biogenesis in the source cell. Examples include epinephrine, norepinephrine, isoproterenol, metoprolol, formoterol, fenoterol and procaterol.
[00760] [00760] In one embodiment, the source cells are modified, for example, genetically modified, to express a transcription activator of mitochondrial biogenesis, for example, a transcription factor or a transcription coactivator, such as PGC1a. In some embodiments, cells express PGC1a (for example, they overexpress an endogenous or exogenous PGC1a). TABLE 4. TRANSCRIPTIONAL CONTROL OF MYTHOCONDRIAL BIOGENESIS. See, for example, Scarpulla et al., "Transcriptional integration of mitochondrial biogenesis" Trends in Endocrinology & Metabolism, Volume 23, Edition 9, p459 to 466, September 2012; Hock et al. "Transcriptional control of mitochondrial biogenesis and function". Annu Rev Physiol. 2009; 71: 177 to 203. Santra et al., "Ketogenic Treatment Reduces Deleted Mitochondrial DNAs in Cultured Human Cells" Ann Neurol. November 2004; 56 (5): 662 to 669. Kanabus et al., "The pleiotropic effects of decanoic acid treatment on mitochondrial function in fibroblasts from patients with complex | deficient Leigh syndrome" J Inherit Metab Dis. 2016 may; 39 (3): 415 to 426, each of which is incorporated herein by reference in its entirety. [sm Ta outamocamíralda o e fot gama; ERRa, b, gamma; GABP; NRF-1; YY1; CREB; c- PGC-1a MYC range; ERRa, b, gamma; GABP; NRF-1; YY1; CREB; c- | xe CSS Co-repressor with PPAR-delta, a, gamma and ERRa, beta, Main regulator, co-activator for PPAR-delta, a, gamma; ERRa, b, gamma; GABP; NRF-1; YY1; CREB; ç-
[00761] [00761] In one aspect, a modification is made to the fusosome. These modifications can be effective, for example, to improve targeting, function or structure.
[00762] [00762] In some embodiments, the fusosome is treated with a fusogen, for example, a chemical fusogen described here, which may be non-covalent or covalently bonded to the membrane surface. In some embodiments, the fusosome is treated with a fusogen, for example, a protein or a lipid fusogen, which may not covalently or covalently bind or be incorporated into the membrane.
[00763] [00763] In some modalities, a ligand is conjugated to the surface of the fusosome by means of a functional chemical group (carboxylic acids, aldehydes, amines, sulfhydryls and hydroxyls) that are present on the surface of the fusosome.
[00764] [00764] Such reactive groups include, without limitation, maleimide groups. As an example, fusosomes can be synthesized to include maleimide-conjugated phospholipids, such as, without limitation, DSPE-MaL-PEG2000.
[00765] [00765] In some embodiments, a small molecule or lipid, synthetic or native, may be covalently or non-covalently | attached to the surface of the fusosome. In some modalities, a membrane lipid in the fusosome can be modified to promote, induce or enhance fusogenic properties.
[00766] [00766] In some embodiments, the fusosome is modified by loading with modified proteins (for example, it allows new functionality, changes post-translational modifications, binds to the mitochondrial membrane and / or mitochondrial membrane proteins, forms a cleavable protein with a heterologous function, forms a protein for proteolytic degradation, analyze the location and levels of the agent or deliver the agent as a carrier). In one embodiment, the invention includes a fusosome loaded with modified proteins.
[00767] [00767] In some embodiments, an exogenous protein is bound non-covalently to the fusosome. The protein can include a cleavable domain for release. In one embodiment, the invention includes a fososome comprising an exogenous protein with a clickable domain.
[00768] [00768] In some embodiments, the fusosome is modified with a protein intended for proteolytic degradation. A variety of proteases recognize specific amino acid sequences of proteins and target proteins for degradation. These protein-degrading enzymes can be used to degrade specific
[00769] [00769] As described here, non-fusogenic additives can be added to the fusosome to modify its structure and / or properties. For example, cholesterol or sphingomyelin can be added to the membrane to help stabilize the structure and prevent leakage of the internal charge. In addition, the membranes can be prepared from hydrogenated egg phosphatidylcholine or egg phosphatidylcholine, cholesterol and dicetyl phosphate. (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, 12 pages, 2011. doi: 10.1155 / 2011/469679 for review).
[00770] [00770] In some embodiments, the fusosome comprises one or more targeting groups (for example, a targeting protein) on the outer surface to target a specific type of cell or tissue (for example, cardiomyocytes). These targeting groups include, without limitation, receptors, ligands, antibodies and the like. These targeting groups link their partners to the surface of the target cells. In the embodiments, the target protein is specific for a cell surface marker on a target cell described herein, for example, a skin cell, cardiomyocyte, hepatocyte, intestinal cell (eg, small intestine cell), cell pan-crema, brain cell, prostate cell, lung cell, colon cell or bone marrow cell.
[00771] [00771] In some embodiments, the targeting protein binds a cell surface marker to a target cell. In fashion, the cell surface marker comprises a protein,
[00772] [00772] In some embodiments, the chemical targeting portion is composed of a polypeptide that is a polypeptide separated from the fusogen. In some embodiments, the polypeptide comprising a chemical targeting portion comprises a transmembrane domain and an extracellular targeting domain. In modalities, the extracellular targeting domain comprises a scFv, DARPIin, nanobody, receptor ligand or antigen. In some embodiments, the extracellular targeting domain comprises an antibody or antigen-binding fragment (for example, Fab, Fab ', F (ab') 2, Fv fragments, scFv antibody fragments, Fvs bound to disulfide (sdFv), an Fd fragment consisting of the VH and CH1 domains, linear antibodies, single domain antibodies, such as sdAb domains (VL or VH) or VHH camelids), a support for fibronectin binding to the type II antigen ( Fn3), such as a fibronectin polypeptide antibody, a ligand, a cytokine, a chemokine, or a T cell receptor (TCRs).
[00773] [00773] In some embodiments, the fusosome described here is functionalized with a diagnostic agent. Examples of diagnostic agents include, but are not limited to, commercially available imaging agents used in positron emission tomography (PET), computer aided tomography (CAT), single photon emission tomography, x-ray, fluoroscopy and magnetic resonance imaging (MRI); and contrast agents. Examples of materials suitable for use as contrast agents in MRI include gadolinium chelates, as well as iron, magnesium, manganese, copper and chromium.
[00774] [00774] Another example of introducing functional groups to smoking
[00775] [00775] In some embodiments, a fusosome described here includes a charge, for example, subcellular charge.
[00776] [00776] In some embodiments, a fusosome described herein includes a charge, for example, a therapeutic agent, for example, an endogenous therapeutic agent or an exogenous therapeutic agent.
[00777] [00777] In some modalities, the charge is not naturally expressed in the cell from which the fuososme is derived. In some modalities, the charge is naturally expressed in the cell from which the fusosome is derived. In some embodiments, the charge is a mutant of a wild-type nucleic acid or protein expressed naturally in the cell from which the fusosome is derived or is a wild-type mutant expressed naturally in the cell from which the fusosome is derived.
[00778] [00778] In some embodiments, the charge is loaded on the spindle-sum via expression in the cell from which the fusosome is derived (for example, expression of DNA or mRNA introduced by transfection, transduction or electroporation). In some modalities, the charge is expressed from the DNA integrated into the genome or maintained episodically.
[00779] [00779] In some modalities, the charge is charged in the spindle-sum by electroporation in the fusosome itself or in the cell from which the fusosome is derived. In some embodiments, the charge is loaded on the fusosome by transfection (for example, of a DNA or mRNA encoding the charge) on the fusosome itself or on the cell from which the fososome is derived.
[00780] [00780] In some respects, the description provides a fusosome composition (for example, a pharmaceutical composition) comprising:
[00781] [00781] (i) one or more of a chondrosome (for example, as described in an international application, PCT / US16 / 64251), a mitochondria, an organelle (for example, mitochondria, lysosomes, nucleus, cell membrane, cytoplasm , endoplasmic reticulum, ribosomes, vacuoles, endosomes, spliceosomes, polymerases, capsids, acrosome, autophagosome, centriole, glycosome, glyoxysome, hydro-genosome, melanosome, mitosome, myofibril, cnidocyst, peroxisome, stress, proteasome, stress, stress, and organelle networks) or an enucleated cell, for example, an enucleated cell comprising any of the above, and (ii) a fusogen, for example, a myomal protein.
[00782] [00782] In modalities, fusogen is present in a lipid bilayer external to the mitochondrium or chondrosome. In the modalities, the chondroma has one or more of the properties described, for example, in international application, POCT / US16 / 64251, which is incorporated herein by reference in its entirety, including the Examples and the Summary of the Invention.
[00783] [00783] In some embodiments, the charge may include one or more nucleic acid sequences, one or more polypeptides, a combination of nucleic acid and / or polypeptide sequences, one or more organelles and any combination thereof. In some embodiments, the charge may include one or more cellular components. In some modalities, the load includes one or more cytosolic and / or nuclear components.
[00784] [00784] In some embodiments, the charge includes a nucleic acid, for example, DNA, nDNA (nuclear DNA), mtDNA (mitochondrial DNA), DNA encoding proteins, gene, operon, chromosome, genome, transposon, retrotransposon, viral genome , intron, exon, modified DNA, mMRNA (messenger RNA), tRNA (transfer RNA), modified RNA, microRNA, siRNA (small interfering RNA), tmRNA (transfer messenger RNA), rRNA (ribosomal RNA), mtRNA (Mitochondrial RNA), snRNA (small nuclear RNA), small nucleolar RNA (snoRNA), SmY RNA (MRNA trans-splicing RNA), gRNA (guide RNA), TERC (telomerase RNA component), aRNA (antisense RNA) , cis-NAT (Cis natural antisense transis), CRISPR RNA (crRNA), IncRNA (non-long coding RNA), piRNA (RNA that interacts with piwi), ShRNA (short hairpin RNA), tasiRNA (trans action siRNA) , eERNA (RNA enhancer), satellite RNA, pcºRNA (protein encoding RNA), dsRNA (double-stranded RNA), RNAi (interfering RNA), circRNA (circulating RNA) home), reprogramming RNAs, aptamers and any combination thereof. In some embodiments, the nucleic acid is a wild-type nucleic acid. In some embodiments, the protein is a mutant nucleic acid. In some embodiments, the nucleic acid is a fusion or chimera of multiple nucleic acid sequences.
[00785] [00785] In some embodiments, the DNA in the fusosome or DNA in the cell from which the fusosome is derived is edited to correct a genetic mutation using gene editing technology, for example, a guide RNA and CRISPR-Cas9 / Cpf1 or using a different targeted endonuclease (for example, zinc finger nucleases, transcription activator-type nucleases (TALENs)). In some ways, the genetic mutation is linked to a disease in a subject. Examples of DNA edits include small insertions / deletions, large deletions, corrections of genes with model DNA or large DNA insertions. In some modalities, gene editing is performed with non-homologous final union (NHEJ) or homology-directed repair (HDR). In some modalities, editing is a knockout. In some modalities, the edition is a knock-in. In some modes, both DNA alleles are edited. In some modes, a single allele is edited. In some modalities, several editions are made. In some embodiments, the fusosome or cell is derived from a subject, or is genetically compatible with the subject, or is immunologically compatible with the subject (for example, having similar MHC).
[00786] [00786] In some embodiments, the charge may include a nucleic acid. For example, the charge may comprise RNA to improve the expression of an endogenous protein, or a siRNA or miRNA that inhibits the protein expression of an endogenous protein. For example, endogenous protein can modulate the structure or function in target cells. In some embodiments, the charge may include a nucleic acid that encodes a engineered protein that modulates the structure or function in the target cells. In some embodiments, the charge is a nucleic acid that targets a transcriptional activator that modulates the structure or function in the target cells.
[00787] [00787] In some embodiments, the charge includes a polypeptide,
[00788] [00788] In some embodiments, the charge includes a small molecule, for example, ions (eg, Ca *, CI, Fe *), Carbohydrates, lipids, reactive oxygen species, reactive nitrogen species, isoprenoids , signaling molecules, heme, polypeptide cofactors, electron acceptor compounds, electron donor compounds, metabolites, ligands and any combination thereof. In some embodiments, the small molecule is a drug that interacts with a target in the cell. In some embodiments, the small molecule targets a protein in the cell for degradation. In some embodiments, the small molecule targets a protein in the cell for degradation, locating the protein in the proteasome. In some embodiments, this small molecule is a chimeric molecule directed to proteolysis (PROTAC).
[00789] [00789] In some embodiments, the charge includes a mixture of proteins, nucleic acids or metabolites, for example, multiple polypeptides, multiple nucleic acids, multiple small molecules; combinations of nucleic acids, polypeptides and small molecules; ribonucleoprotein complexes (for example, Cas9-gRNA complex); multiple transcription factors, multiple epigenetic factors, reprogramming factors (for example, Oct4, Sox2, cMyc and KIf4); Multiple regulatory RNAs; and any combination thereof.
[00790] [00790] In some embodiments, the charge includes one or more organelles, for example, chondrosomes, mitochondria, lysosomes, nucleus, cell membrane, cytoplasm, endoplasmic reticulum, ribosomes, ribosomes, vacuoles, endosomes, spliceosomes, polymerases, capsids, acrosome, autophagosome, centriol, glycosome, glyoxysome, hydrogenosome, melanosome, mitosome, myofibril, enidocyst, peroxisome, proteasome, vesicle, stress granule, organelle networks and any combination thereof.
[00791] [00791] In some modalities, the charge is enriched in the spindle-sum or in the cell membrane. In some embodiments, the charge is enriched by directing to the membrane through a peptide signal sequence. In some embodiments, the charge is enriched by binding to a protein, lipid or small molecule associated with the membrane. In some embodiments, the charge binds covalently to a protein, lipid or small molecule associated with the member.
[00792] [00792] In one aspect, the fusosome, for example, a pharmaceutical composition of fusosomes, or a composition of fusosomes, comprises isolated chondrosomes (for example, a chondrosome preparation), derived from a cellular source of mitochondria.
[00793] [00793] In another aspect, the fusosome, for example, a pharmaceutical composition of fusosomes, or a composition of fusosomes, comprises isolated and modified chondrosomes (for example, modified chondrosome preparation) derived from a cell source mitochondria.
[00794] [00794] In another aspect, the fusosome, for example, a pharmaceutical composition of fusosomes, or a composition of fusosomes, comprises chondrosomes (for example, preparation of chondrosomes) expressing an exogenous protein.
[00795] [00795] “Additional resources and modalities, including chondrosomes (for example, chondrosomal preparations), methods and uses disclosed in this document include one or more of the following.
[00796] [00796] In some modalities, the chondrosome (or chondrosomes in the composition) has one or more (2, 3, 4, 5, 6, 7, 8, 92 or more, for example, all) of the following characteristics:
[00797] [00797] integrity of the external chondroma membrane, where the composition exhibits <20% (for example, <15%, <10%, <5%, <4%, <3%, <2%, <1%) increase in oxygen consumption rate over state 4 rate after addition of reduced cytochrome c;
[00798] [00798] genetic quality> 80%, for example,> 85%,> 90%,> 95%,> 97%,> 98%,> 99%, where "genetic quality" of a chondroma preparation means , for all sites described in Table 5, the sequencing percentage reads the mapping for the wild type allele;
[00799] [00799] 3/2 glutamate / malate RCR from 1 to 15, for example, 2 to 15, 5 to 15, 2a 10, 2a 5, 10a15;
[00800] [00800] 3/40 glutamate / malate RCR from 1 to 30, 1 to 20, 2a20.5 to 20.3 to 15, 10 to 30;
[00801] [00801] succinate / rotenone 3/2 RCR from 1a 15, 2a15.5a15.1 to 10.10 a15;
[00802] [00802] - "RCR succinate / rotenone 3/40 from 1 to 30, 1 to 20.2 to 20, 5 to 20, 3 to 15, 10 to 30;
[00803] [00803] respiratory control ratio of palmitoyl carnitine and malate RCR3 / 2 state 3 / state 2 (RCR 3/2) from 1 to 10 (for example, 1 to 5);
[00804] [00804] cardiolipin content 0.05 to 25 (0.1 to 20.0.5 to 20.1 to 20.5 to 20, 5 to 25, 1 to 25, 10 to 25, 15 to 25) 100 * pmol / mol of lipid total;
[00805] [00805] genomic protein concentration at 0.001 to 2 (for example, 0.001 to 1, 0.01 to 1, 0.01 to 1, 0.01 to 0.05, 0.1 to 0.2) mtDNA ug / mg; or
[00806] [00806] relative mMtDNA / nuclear DNA ratio of> 1000 (e.g.,> 1,500,> 2000,> 2,500,> 3,000,> 4,000,> 5,000,>
[00807] [00807] In some modalities, the chondrosome (or chondrosomes in the composition) has one or more (2, 3, 4, 5, 6 or more) of the following characteristics:
[00808] [00808] the chondromas in the composition have an average size between 150 to 1500 nm, for example, between 200 to 1200 nm, for example, between 500 to 1200 nm, for example, 175 to 950 nm;
[00809] [00809] chondromas in the composition have a polydispersity (D90 / D10) between 1.1 and 6, for example, between 1.5 and 5. In modalities, chondromas in the composition of a cultivated cell source (for example, cultured fibroblasts) have a polydispersity (D90 / D10) between 2 to 5, for example, between 2.5 to 5;
[00810] [00810] integrity of the external chondroma membrane where the composition exhibits <20% (for example, <15%, <10%, <5%, <4%, <3%, <2%, <1%) increase in the rate of oxygen consumption over state 4 rate after addition of reduced cytochrome c;
[00811] [00811] level of complex | from 1 to 8 mOD / ug of total protein, for example, 3 to 7 mOD / ug of total protein, 1 to 5 mMOD / ug of total protein. In modalities, the chondromas of a preparation from a cultured cell source (for example, cultured fibroblasts) have a complex level | from 1 to 5 mOD / ug of total protein;
[00812] [00812] IL complex level of 0.05 to 5 mOD / ug of total protein, for example, 0.1 to 4 mOD / ug of total protein, for example, 0.5 to 3 mOD / ug of total protein. In embodiments, the chondromas of a preparation from a cultured cell source (for example, cultured fibroblasts) have an IL complex level of 0.05 to 1 mOD / ug of total protein;
[00813] [00813] Ill complex level of 1 to 30 mOD / ug of total protein, for example, 2 to 30, 5 to 10, 10 to 30 mOD / ug of total protein. In embodiments, the chondromasomes of a cultured cell source (e.g., cultured fibroblasts) have an Ill complex level of 1-5 mOD / ug of total protein;
[00814] [00814] level of complex IV of 4 to 50 mOD / ug of total protein, for example, 5 to 50, for example, 10 to 50, 20 to 50 mOD / ug of total protein. In modalities, the chondromasomes of a cultured cell source (for example, cultured fibroblasts) have a level of complex IV of 3 to 10 mMOD / ug of total protein;
[00815] [00815] genomic concentration 0.001 to 2 (for example, 0.001 to 1, 0.01 to 1, 0.01 to 1, 0.01 to 0.05, 0.1 to 2) MtDNA ug / mg protein;
[00816] [00816] membrane potential of the preparation is between -5 to -200 mV, for example, between -100 to -200 mV, -50 to -200 mV, -50 to -75 mV, -50 to -100 mV. In some embodiments, the membrane potential of the preparation is less than -150mV, less than -100mV, less than - T75mV, less than -50mV, for example, -5 to -20mV;
[00817] [00817] a carbonyl protein level of less than 100 nmol of carbonyl / mg of chondrosome protein (for example, less than 90 nmol of carbonyl / mg of chondrosome protein, less than 80 nmol of carbonyl / mg of chondrosome protein , less than 70 nmol carbon / mg chondrosomal protein, less than 60 nmol carbonyl / mg chondrosomal protein, less than 50 nmol carbonyl / mg chondrosomal protein, less than 40 nmol carbonyl / mg chondrosomal protein , less than 30 nmol carbonyl / mg chondrosomal protein, less than 25 nmol carbonyl / mg chondrosomal protein, less than 20 nmol carbonyl / mg chondrosomal protein, less than nmol carbonyl / mg chondrosomal protein, less than 10 nmol carbonyl / mg chondrosomal protein, less than 5 nmol carbonyl / mg chondrosomal protein, less than 4 nmol carbonyl / mg chondrosomal protein, less than 3 nmol carbonyl / mg chondrosome protein;
[00818] [00818] <20% mol / mol ER proteins (e.g.,> 15%,> 10%,> 5%,> 3%,> 2%,> 1%) mol / mol ER proteins;
[00819] [00819]> 5 mol / mol% of mitochondrial proteins (proteins identified as mitochondrial in the MitoCarta database (Calvo et al., NAR 2015]! Doi: 10.1093 / nar / gkv1003)), for example,> 10% ,> 15%,> 20%,> 25%,> 30%,> 35%,> 40%; > 50%,> 55%,> 60%,> 65%,> 70%,> 75%,> 80%; > 90 mol / mol% of mitochondrial proteins);
[00820] [00820]> 0.05 mol / mol% of MT-CO2, MT-ATP6, MT-ND5 and MT-ND6 protein (combined) (e.g.> 0.1%;> 0.5%,> 1% ,> 2%,> 3%,> 4%,> 5%,> 7%,> 8%,> 9%,> 10%,> 15 mol / mol% of MT-CO protein> 2, MT -ATP6, MT-ND5 and MT-ND6);
[00821] [00821] genetic quality> 80%, for example,> 85%,> 90%,> 95%,> 97%,> 98%,> 99%;
[00822] [00822] the relative mtDNA / nuclear DNA ratio is> 1000 (for example,> 1,500,> 2,000,> 2,500,> 3,000,> 4,000,> 5,000,> 10,000,>
[00823] [00823] endotoxin level <0.2 EU / ug protein (e.g., <0.1, 0.05, 0.02, 0.01 EU / ug protein);
[00824] [00824] —exogenous human resonance substantially absent;
[00825] [00825] 3/2 glutamate / malate RCR from 1 to 15, for example, 2 to 15.5a15.2a10.2a5.10a15;
[00826] [00826] 3/40 glutamate / malate RCR from 1 to 30, 1st 20.2 to 20.5 to 20, 3rd 15, 10 to 30;
[00827] 3/2 succinate / rotenone RCR from 1 to 15, 2a15.5a15.1 to 10.10 to15;
[00828] [00828] 3/40 succinate / rotenone RCR from 1 to 30, 1 to 20.2 to 20, 5 to 20, 3 to 15, 10 to 30;
[00829] [00829] activity of the complex | from 0.05 to 100 nmol / min / mg of total protein (for example, 0.05 to 50, 0.05 to 20, 0.5 to 10, 0.1 to 50, 1a 50, 2 to 50 , 5 to 100, 1 to 20 nmol / min / mg of total protein);
[00830] [00830] Il complex activity from 0.05 to 50 nmol / min / mg of total protein (for example, 0.05 to 50, 0.05 to 20, 0.5 to 10, 0.1 to 50 , 1a 50, 2 to 50, 5 to 50, 1 to 20 nmol / min / mg of total protein);
[00831] [00831] Ill complex activity from 0.05 to 20 nmol / min / mg of total protein (for example, 0.05 to 50, 0.05 to 20, 0.5 to 10, 0.1 to 50 , 1 to 50, 2 to 50, 5 to 100, 1 to 20 nmol / min / mg of total protein);
[00832] [00832] complex IV activity from 0.1 to 50 nmol / min / mg of total protein (for example, 0.05 to 50, 0.05 to 20, 0.5 to 10, 0.1 to 50 , 1 to 50, 2 to 50, 5 to 50, 1 to 20 nmol / min / mg of total protein);
[00833] [00833] V complex activity from 1 to 500 nmol / min / mg of total protein (for example, 10 to 500, 10 to 250, 10 to 200, 100 to 500 nmol / min / mg of total protein);
[00834] [00834] reactive oxygen species (ROS) level of production of
[00835] [00835] citrate synthase activity from 0.05 to 5 (e.g., 0.5 to 5, 0.5 to 2, 1 to 5, 1 to 4) MOD / min / ug of total protein;
[00836] [00836] alpha ketoglutarate dehydrogenase activity from 0.05 to 10 (for example, 0.1 to 10, 0.1 to 8.0.5a8.0.1a5.0.5a5.0.5a3.1a3) mOD / min / ug total protein;
[00837] [00837] creatine kinase activity from 0.1 to 100 (for example, 0.5 to 50, 1 to 100, 1 to 50, 1 to 25, 1 to 15, 5 to 15) MOD / min / ug of protein total ine;
[00838] [00838] pyruvate dehydrogenase activity from 0.1 to 10 (for example, 0.5 to 10, 0.5 to 8, 1 to 10, 1 to 8, 1 to 5, 2a 3) MOD / min / ug of total protein;
[00839] [00839] aconitase activity from 0.1 to 50 (e.g., 5 to 50, 0.1 to 2, 0.1 to 20, 0.5 to 30) mMOD / min / ug of total protein. In modalities, the activity of aconitase in a chondrosomal preparation from platelets is between 0.5 to 5 MOD / min / ug of total protein. In modalities, the activity of aconitase in a chondrosomal preparation from cultured cells, for example, fibroblasts, is between 5 to 50 mMOD / min / ug of total protein;
[00840] [00840] maximum fatty acid oxidation level from 0.05 to 50 (e.g. 0.05 to 40, 0.05 to 30, 0.05 to 10, 0.5 to 50, 0.5 to 25, 0.5 to 10, 1 to 5) pmol Oz / min / ug of chondroma protein;
[00841] [00841] respiratory control ratio of palmitoyl carnitine and malate RCR3 / 2 state 3 / state 2 (RCR 3/2) from 1 to 10 (for example, 1 to 5);
[00842] [00842] electron transport chain efficiency from 1 to 1000 (e.g. 10 to 1000, 10 to 800, 10 to 700, 50 to 1000, 100 to 1000, 500 to 1000, 10 to 400, 100 to 800) nmol Om / min / mg protein / AGATP (in kcal / mol);
[00843] [00843] total lipid content of 50,000 to 2,000,000 pmol / mg (for example, 50,000 to 1,000,000; 50,000 to 500,000 pmol / mg);
[00844] [00844] double bond / total lipid ratio of 0.8 to 8 (for example, 1a 5.2a5.1a7.1a6) pmol / pmol;
[00845] [00845] phospholipid / total lipid ratio from 50 to 100 (e.g., 60 to 80, 70 to 100, 50 to 80) 100 * pmol / pmol;
[00846] [00846] phosphosphingolipid / total lipid ratio of 0.2 to 20 (for example, 0.5 to 15, 0.5 to 10, 1 to 10, 0.5 to 10, 1 to 5, 5 to 20) 100 * pmol / pmol;
[00847] [00847] 0.05 to 5 ceramide content (for example, 0.1 to 5.0.1 to 4.1 to 5, 0.05 to 3) 100 * in pmol / mo · l of total lipid;
[00848] [00848] cardiolipin content 0.05 to 25 (0.1 to 20.0.5 to 20.1 to 20.5 to 20, 5 to 25, 1 to 25, 10 to 25, 15 to 25) 100 * pmol / mol of lipid total;
[00849] [00849] smooth-phosphatidylcholine (LPC) content from 0.05 to 5 (for example, 0.1 to 5.1 to 5.1 to 3.1 to 3.0) 100 * pmol / mol of total lipid;
[00850] [00850] smooth-phosphatidylethanolamine (LPE) content of 0.005 to 2 (for example, 0.005 to 1, 0.05 to 2, 0.05 to 1) 100 * pmol / mo · l of total lipid;
[00851] [00851] phosphatidylcholine (PC) content from 10 to 80 (e.g., 20 to 60, 30 to 70, 20 to 80, 10 to 60 m 30 to 50) 100 * pmol / mol of total lipid;
[00852] [00852] phosphatidylcholine-ether (PC O-) content 0.1 to 10 (e.g. 0.5 to 10, 1a 10.2 to 8, 1 to 8) 100 * in pmol / mol of total lipid;
[00853] [00853] phosphatidylethanolamine (PE) content 1 to 30 (e.g., 2 to 20, 1 to 20, 5 to 20) 100 * pmol / mo · l of total lipid;
[00854] [00854] phosphatidylethanolamine-ether (PE O-) content 0.05 to 30 (e.g. 0.1 to 30, 0.1 to 20, 1 to 20, 0.1 to 5, 1 to 10, 5 to 20 ) 100 * pmol / pmo! L of total lipid;
[00855] [00855] phosphatidylinositol (PI) content 0.05 to 15 (e.g. 0.1 to 15, 0.1 to 10, 1 to 10, 0.1 to 5, 1 to 10, 5 to 15) 100 * pmol / mo! l of total lipid;
[00856] [00856] phosphatidylserine (PS) content 0.05 to 20 (e.g. 0.1 to 15, 0.1 to 20, 1 to 20, 1 to 10, 0.1 to 5, 1 to 10.5 to 15) 100 * in pmol / mol of total lipid;
[00857] [00857] sphingomyelin (SM) content 0.01 to 20 (e.g. 0.01 to 15, 0.01 to 10, 0.5 to 20, 0.5 to 15, 1 to 20, 1 to 15, 5 to 20) 100 * in pmol / mol of total lipid;
[00858] [00858] triacylglycerol (TAG) content 0.005 to 50 (e.g. 0.01 to 50, 0.1 to 50, 1 to 50, 5 to 50, 10 to 50, 0.005 to 30, 0.01 to 25, 0.1 to 30) 100 * pmol / pmo! L of total lipid;
[00859] [00859] “Ratio PE: LPE from 30 to 350 (for example, 50 to 250, 100 to 200, 150 to 300);
[00860] [00860] PC: LPC ratio 30 to 700 (e.g. 50 to 300, 50 to 250, 100 to 300, 400 to 700, 300 to 500, 50 to 600, 50 to 500, 100 to 500, 100 to 400 );
[00861] [00861] Teorde PE 18: n (n> 0) from 0.5 to 20% (for example, 1 to 20%, 1 to 10%, 5 to 20%, 5 to 10%, 3 to 9%) pmol AA / pmol lipid class;
[00862] [00862] “Teorde PE 20: 4 from 0.05 to 20% (for example, 1 to 20%, 1 to 10%, 5 to 20%, 5 to 10%) pmol AA / pmol lipid class;
[00863] [00863] Teorde PC 18: n (n> 0) of 5Sa50% (for example, 5 to 40%, 30%, 20 to 40%, 20 to 50%) pmol AA / pmo! L lipid class;
[00864] [00864] Teorde PC 20: 4 from 1 to 20% (for example, 2 to 20%, 2a 15%, 5 to 20%, 5 to 15%) pmol AA / pmol lipid class.
[00865] [00865] In certain modalities, chondrosome (or chondrosomes in the composition) has one or more of the following characteristics after administration to a recipient cell, tissue or subject (a control can be a negative control (for example, a control tissue or subject that has not been administered a composition) or a baseline prior to administration, for example, a cell, tissue or subject prior to administration of the composition):
[00866] [00866] Increases baseline respiration of recipient cells by at least 10% (e.g.> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70%,> 80% ,> 90%) in relation to a control;
[00867] [00867] —condrosomes in the composition are absorbed in at least 1% (for example, at least 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%) of recipient cells;
[00868] [00868] the chondromas in the composition are absorbed and maintain the membrane potential in the recipient cells;
[00869] [00869] - chondrosomes in the composition persist in the receiving cells for at least 6 hours, for example, at least 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, a week, 2 weeks, a month , 2 months, 3 months, 6 months;
[00870] [00870] increases ATP levels in a recipient cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00871] [00871] decreases apotheosis in a recipient cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% , 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00872] [00872] decreased levels of cellular lipids in a cell, tissue or recipient subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00873] [00873] increases the membrane potential in a receiving cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00874] [00874] increases decoupled respiration in a receiving cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 509 %, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00875] [00875] increases PISK activity in a recipient cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45 %, 509%, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00876] [00876] reduces the reductive stress in a receiving cell, tissue or subject (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 509 %, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00877] [00877] decreases reactive oxygen species (for example H20O> 2) in the cell, tissue of the subject (for example, in the serum of a target subject) (for example, by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 509%, 60%, 70%, 80%, 90% or more, for example, compared to a reference value, for example, a control value, for example, an untreated control);
[00878] [00878] decreases cell lipid levels of recipient cells by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70 %,> 80%,> 90%) in relation to a control;
[00879] [00879] increases the decoupled respiration of the recipient cells by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70% ,> 80%,> 90%) in relation to a control;
[00880] [00880] decreased the formation of transition pores of mitochondrial permeability (MPTP) in the recipient cells by at least 5% and does not increase more than 10% in relation to a control;
[00881] [00881] increases AKkt levels in recipient cells by at least 10% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70 %,> 80%,> 90%) in relation to a control;
[00882] [00882] decreases the total NAD / NADH ratio in recipient cells by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%, > 70%,> 80%,> 90%) in relation to a control;
[00883] [00883] reduces ROS levels in recipient cells by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70 %,> 80%,> 90%) in relation to a control;
[00884] [00884] increases fractional shortening in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60% ,> 70%,> 80%,> 90%) in relation to a control;
[00885] [00885] increases the final diastolic volume in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%, > 70%,> 80%,> 90%) in relation to a control;
[00886] [00886] decreases the final stroke volume in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%, > 70%,> 80%,> 90%) in relation to a control;
[00887] [00887] decreases the area of ischemic heart infarction by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%,> 70 %,> 80%,> 90%) in relation to a control;
[00888] [00888] increases stroke volume in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60% ,> 70%,> 80%,> 90%) in relation to a control;
[00889] [00889] increases the ejection fraction in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60 %,> 70%,> 80%,> 90%) in relation to a control
[00890] [00890] “increases cardiac output in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60 %,> 70%,> 80%,> 90%) in relation to a control;
[00891] [00891] increases the cardiac index in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60% ,> 70%,> 80%,> 90%) in relation to a control;
[00892] [00892] “decreases serum CKNB levels in subjects with cardiac ischemia by at least 5% (for example,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%, > 60%,> 70%,> 80%,> 90%) in relation to a control;
[00893] [00893] decreased serum cTnl levels in subjects with cardiac ischemia by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60%, > 70%,> 80%,> 90%) in relation to a control;
[00894] [00894] decreases serum hydrogen peroxide in subjects with cardiac ischemia by at least 5% (eg> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60% ,> 70%,> 80%,> 90%) in relation to a control;
[00895] [00895] decreased serum levels of cholesterol and / or triglycerides in a subject by at least 5% (e.g.,> 10%,> 15%,> 20%,> 30%,> 40%,> 50%,> 60 %,> 70%,> 80%,> 90%) in relation to a control.
[00896] [00896] In some embodiments, the fusosome comprises a chondrosome, for example, chondrosomes isolated from a mitochondrial source, having one or more of the following characteristics:
[00897] [00897] the chondromas in the composition have an average size between 150 to 1500 nm;
[00898] [00898] the chondrosomes in the composition have a polydispersity (D90 / D10) between 1.1 and 6;
[00899] [00899] the integrity of the membrane of the external chondrosome of the chondrosomes in the composition shows an increase <20% in the rate of oxygen consumption over the rate of state 4 after the addition of reduced cytochrome c;
[00900] [00900] level of the complex | from 1 to 8 MOD / ug of total protein;
[00901] [00901] - level of the complex | l of 0.05 to 5 mOD / ug of total protein;
[00902] [00902] - level of the Ill complex from 1 to 30 mOD / ug of total protein;
[00903] [00903] - level of complex IV from 4 to 50 mMOD / ug of total protein;
[00904] [00904] “genomic concentration 0.001 to 2 mtDNA ug / mg protein; and / or
[00905] [00905] membrane potential of the chondromas in the composition is between -5 and -200 mV.
[00906] [00906] In some embodiments, the fusosome comprises a chondrosome, for example, chondrosomes isolated from a mitochondrial source, having one or more of the following characteristics:
[00907] [00907] a carbonyl protein level lower than 100 nmol of carbonyl / mg of chondroma protein.
[00908] [00908] <20 mol / mol% of ER proteins
[00909] [00909]> 5% of mitochondrial mol / mol proteins (MitoCarta);
[00910] [00910]> 0.05 mol / mol% of MT-CO2, MT-ATP6, MT-ND5 and MT-ND6 protein;
[00911] [00911] genetic quality> 80%;
[00912] [00912] relative mMtDNA / nuclear DNA ratio> 1,000;
[00913] [00913] endotoxin level <0.2 EU / ug protein; and / or
[00914] [00914] - exogenous non-human serum substantially absent.
[00915] [00915] In some embodiments, the fusosome comprises a chondrosome, for example, chondrosomes isolated from a mitochondrial source, having one or more of the following characteristics:
[00916] [00916] 3/2 glutamate / malate RCR from 1 to 15;
[00917] [00917] 3/40 glutamate / malate RCR from 1 to 30;
[00918] [00918] 3/2 succinate / rotenone RCR from 1 to 15;
[00919] [00919] 3/40 succinate / rotenone RCR from 1 to 30;
[00920] [00920] activity of the complex | from 0.05 to 100 nmol / min / mg of total protein;
[00921] [00921] Il complex activity from 0.05 to 50 nmol / min / mg of total protein;
[00922] [00922] Ill complex activity from 0.05 to 20 nmol / min / mg of total protein;
[00923] [00923] complex IV activity from 0.1 to 50 nmol / min / mg of total protein;
[00924] [00924] V complex activity from 1 to 500 nmol / min / mg of total protein;
[00925] [00925] reactive oxygen species (ROS) production level from 0.01 to 50 pmol H2O2 / ug protein / hour;
[00926] [00926] citrate synthase activity from 0.05 to 5 mMOD / min / ug of total protein;
[00927] [00927] alpha ketoglutarate dehydrogenase activity from 0.05 to 10 mOD / min / ug of total protein;
[00928] [00928] creatine kinase activity from 0.1 to 100 mOD / min / ug of total protein;
[00929] [00929] pyruvate dehydrogenase activity from 0.1 to 10 MOD / min / ug of total protein;
[00930] [00930] accitosis activity from 0.1 to 50 mMOD / min / ug of total protein;
[00931] [00931] maximum fatty acid oxidation level of 0.05 to 50 pmol O> 2 / min / ug of chondroma protein;
[00932] [00932] respiratory control ratio of palmitoyl carnitine and malate RCR3 / 2 state 3 / state 2 (RCR 3/2) from 1 to 10; and / or
[00933] [00933] electron transport chain efficiency from 1 to 1,000 nmol O2z / min / mg protein / AGATP (in kcal / mol).
[00934] [00934] In some embodiments, the fusosome comprises chondrosomes, for example, chondrosomes isolated from a mitochondrial source, having one or more of the following characteristics:
[00935] [00935] total lipid content from 50,000 to 2,000,000 pmol / mg;
[00936] [00936] double bond / total lipid ratio of 0.8 to 8 pmol / pmol;
[00937] [00937] phospholipid / total lipid ratio of 50 to 100 100 * pmol / pmol;
[00938] [00938] phosphosphingolipid / total lipid ratio of 0.2 to 20 100 * pmol / pmol;
[00939] [00939] 0.05 to 5 ceramide content 100 * pmol / pmol of total lipid;
[00940] [00940] cardiolipin content 0.05 to 25 100 * pmol / pmo! L of total lipid;
[00941] [00941] smooth-phosphatidylcholine (LPC) content of 0.05 to 5 100 * pmol / pmo! L of total lipid;
[00942] [00942] smooth-phosphatidylethanolamine (LPE) content of 0.005 to 2 with total lipid at 100 * pmol / pmol;
[00943] [00943] phosphatidylcholine (PC) content from 10 to 80 with total lipid at 100 * pmol / pmol;
[00944] [00944] phosphatidylcholine-ether (PC O-) content 0.1 to 10 with total lipid at 100 * pmol / pmol;
[00945] [00945] content of phosphatidylethanolamine (PE) 1 to 30 with total lipid at 100 * pmol / pmol;
[00946] [00946] content of phosphatidylethanolamine-ether (PE O-) 0.05 to 30 with total lipid at 100 * pmol / pmol;
[00947] [00947] phosphatidylinositol (PI) content 0.05 to 15 with total lipid at 100 * pmol / pmol;
[00948] [00948] phosphatidylserine (PS) content 0.05 to 20 with total lipid at 100 * pmol / pmol;
[00949] [00949] sphingomyelin (SM) content 0.01 to 20 with total lipid at 100 * pmol / pmol;
[00950] [00950] triacylglycerol (TAG) content 0.005 to 50 with total lipid at 100 * pmol / pmol;
[00951] [00951] “Ratio of PE: LPE 30 to 350;
[00952] [00952] “PC ratio: LPC 30 to 700;
[00953] [00953] Teorde PE 18: n (n> 0) from 0.5 to 20% pmol AA / pmo! L lipid class;
[00954] [00954] Teorde PE 20: 4 from 0.05 to 20% pmol AA / pmol lipid class;
[00955] [00955] Teorde PC 18: n (n> 0) from 5 to 50% pmol of lipid class AA / pmol; and / or
[00956] [00956] Teorde PC 20: 4de1a20%.
[00957] [00957] In some embodiments, the fusosome comprises a chondrosome, for example, chondrosomes isolated from a mitochondrial source, having one or more of the following characteristics:
[00958] [00958] increases basal respiration of recipient cells by at least 10%;
[00959] [00959] - chondrosomes in the composition are absorbed by at least 1% of the recipient cells;
[00960] [00960] —conditions in the composition are absorbed and maintain the membrane potential in the recipient cells;
[00961] [00961] —condrosomes in the composition persist in the receiving cells for at least 6 hours;
[00962] [00962] decreases the cell lipid levels of the recipient cells by at least 5%;
[00963] [00963] increases the decoupled respiration of the recipient cells by at least 5%;
[00964] [00964] reduces the formation of transition pores of mitochondrial permeability (MPTP) in recipient cells by at least 5% and does not increase by more than 10%;
[00965] [00965] increases Akt levels in recipient cells by at least 10%;
[00966] [00966] decreased the total NAD / NADH ratio in recipient cells by at least 5%; and / or
[00967] [00967] reduces ROS levels in recipient cells by at least 5%.
[00968] [00968] In some embodiments, a fusosome comprising a chondrosome still has one or more of the following characteristics:
[00969] [00969] increases fractional shortening in subjects with cardiac ischemia by at least 5%;
[00970] [00970] increases the final diastolic volume in subjects with cardiac ischemia by at least 5%;
[00971] [00971] decreases the final stroke volume in subjects with cardiac ischemia by at least 5%;
[00972] [00972] decreases the area of ischemic heart infarction by at least 5%;
[00973] [00973] increases stroke volume in subjects with cardiac ischemia by at least 5%;
[00974] [00974] increases the ejection fraction in subjects with cardiac ischemia by at least 5%;
[00975] [00975] increases cardiac output in subjects with cardiac ischemia by at least 5%;
[00976] [00976] increases the cardiac index in subjects with cardiac ischemia by at least 5%;
[00977] [00977] decreases serum CKNB levels in subjects with cardiac ischemia by at least 5%;
[00978] [00978] decreased serum levels of cTnl in subjects with cardiac ischemia by at least 5%; and / or
[00979] [00979] decreases serum hydrogen peroxide in subjects with cardiac ischemia by at least 5%.
[00980] [00980] In modalities, the fusosome comprising a chondrosome is stable for at least 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 7 days, 10 days, 14 days, 21 days , 30 days, 45 days, 60 days, 90 days, 120 days, 180 days or more (for example, at 4ºC, 0ºC, -4ºC or -20ºC, -80ºC).
[00981] [00981] In embodiments, the fusosome comprising an agent (e.g., a chondrosome) can comprise, for example, a natural encapsulation material, synthetic or modified as a material based on lipids, vesicles, exosomes, lipid rafts, coated vesicles with clathrin or platelets (mitoparticle), MSC or microcycle membrane of astrocytes.
[00982] [00982] In modalities, the fusosome comprising a chondrosome is in a composition between 150 to 20,000 ug of protein / ml; between 150 to 15,000 ug / ml; 200 to 15,000 ug / ml; 300 to 15,000 ug / ml; 500 to 15,000 ug / ml; 200 to 10,000 µg / ml; 200 to 5,000 µg / ml; 300 to 10,000 µg / ml; > 200 µg / ml; > 250 µg / ml; > 300 µg / ml; > 350 µg / ml; > 400 µg / ml; > 450 µg / ml; > 500 µg / ml; > 600 µg / ml; > 700 µg / ml; > 800 µg / ml; > 900 µg / ml; > 1 mg / ml; > 2 mg / ml; > 3 mg / ml; > 4 mg / ml; > 5 mg / ml; > 6 mg / ml; > 7 mg / ml; > 8 mg / ml; > 9 mg / ml; > 10 mg / ml; > 11 mg / ml; > 12 mg / ml; > 14 mg / ml; > 15 mg / ml (and, for example, <20 mg / ml).
[00983] [00983] In embodiments, the fusosome comprising a chondrosome does not produce an undesirable immune response in a recipient animal, for example, a recipient mammal like a human (for example, does not significantly increase levels of IL-1-beta , IL-6, GM-CSF, TNF-alpha or lymph node size, at the receptor).
[00984] [00984] “Changes in the load include, for example, changes in chondrosomes or in the source of chondrosomes, as described in an international application, POCT / US16 / 64251. In some modalities, the fusosome comprises a chondrosome made using a method to make a pharmaceutical composition described herein.
[00985] [00985] In some embodiments, a fusosome composition described herein, for example, a fusosome composition comprised
[00986] [00986] In some embodiments of any of the aspects described herein, the fusosome composition is substantially non-immunogenic. Immunogenicity can be quantified, for example, as described herein.
[00987] [00987] In some embodiments, a fusosome fuses with a target cell to produce a receptor cell. In some modalities, a recipient cell that has fused with one or more spindles is evaluated for immunogenicity. In the modalities, a recipient cell is analyzed for the presence of antibodies on the cell surface, for example, by staining with an anti-IgM antibody. In other embodiments, immunogenicity is assessed by a PBMC cell lysis assay. In the modalities, a recipient cell is incubated with peripheral blood mononuclear cells (PBMCs) and then evaluated for cell lysis by PBMCs. In other embodiments, immunogenicity is assessed by a killer natural cell lysis (NK) assay. In the embodiments, a recipient cell is incubated with NK cells and then evaluated for cell lysis by NK cells. In other embodiments, immunogenicity is assessed by a CD8 + T cell lysis assay. In the modalities, a recipient cell is incubated with CD8 + T cells and then evaluated for cell lysis by CD8 + T cells.
[00988] [00988] In some embodiments, the fusosome composition has membrane symmetry of a cell that is, or is known to be substantially non-immunogenic, for example, a stem cell, mesenchymal stem cell, induced pluripotent stem cell, - embryonic stem, Sertoli cell or retinal pigment epithelial cell. In some modalities, the fusosome has an immunogenicity of no more than 5%, 10%, 20%, 30%, 40% or 50% greater than the immunogenicity of a stem cell, mesenchymal stem cell, pluripotent stem cell induced, embryonic stem cell, Sertoli cell or retinal pigment epithelial cell, as measured by an assay described here.
[00989] [00989] In some embodiments, the fusosome composition comprises high levels of an immunosuppressive agent in comparison with a reference cell, for example, an unmodified cell similar to the source cell or a Jurkat cell. In some modalities, the high level is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 5 times, 10 times, 20 times, 50 times or 100 times. In some embodiments, the fusosome composition comprises an immunosuppressive agent that is absent in the reference cell. In some embodiments, the fusosome composition comprises reduced levels of an immune activating agent compared to a reference cell, for example, an unmodified cell similar to the parent cell or a Jurkat cell. In some modalities, the reduced level is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% in comparison to the reference cell. In some embodiments, the immune activating agent is substantially absent from the fososome.
[00990] [00990] In some embodiments, the fusosome composition comprises a membrane with a substantially similar composition, for example, measured by proteomics, to that of a cell of origin, for example, a cell of substantially non-immunogenic origin. In some embodiments, the fusosome composition comprises a membrane comprising at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% of the membrane proteins of the source cell. In some embodiments, the fusosome composition comprises a membrane comprising membrane proteins expressed at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 90%, 95%, 99% or 100% of the expression level of the membrane proteins in a membrane of the source cell.
[00991] [00991] In some embodiments, the fusosome composition, or the source cell from which the fusosome composition is derived, has one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve or more of the following characteristics:
[00992] [00992] the expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the MHC class | or MHC class | 1, compared to a reference cell, for example, an unmodified cell that is similar to the source cell or a HeLa cell;
[00993] [00993] Db. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of one or more co-stimulating proteins, including but not limited to: LAG3, ICOS-L, ICOS, Ox40L, OX40 , CD28, B7, CD30, CD30L 4-1BB, 4-1BBL, SLAM, CD27, CD70, HVEM, LIGHT, B7-H3 or B7-H4, compared to a reference cell, for example, a non-reference cell modified in another way similar to the source cell or a reference cell described here;
[00994] [00994] cc. expression of surface proteins that suppress the involvement of macrophages, for example, CD47, for example, expression detectable by a method described here, for example, more than 1.5 times, 2 times, 3 times, 4 times, 5 times, 10 times, or more expression of the surface protein that suppresses the involvement of macrophages, for example, CD47, compared to a reference cell, for example, an unmodified cell, otherwise - similar to the original cell, or a Jurkat cell;
[00995] [00995] d. expression of soluble immunosuppressive cytokines, for example, IL-10, for example, expression detectable by a method described herein, for example, more than 1.5 times, 2 times, 3 times, 4 times, 5 times, 10 times , or more expression of soluble immunosuppressive cytokines, for example, IL-10, compared to a reference cell, for example, an unmodified cell otherwise similar to the source cell or a Jurkat cell;
[00996] [00996] e.expression of soluble immunosuppressive proteins, for example, PD-L1, for example, expression detectable by a method described herein, for example, more than 1.5 times, 2 times, 3 times, 4 times, 5 times, 10 times, or more expression of soluble immunosuppressive proteins, for example, PD-L1, compared to a reference cell, for example, an unmodified cell similar to the source cell, or a cell Jurkat;
[00997] [00997] f less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of soluble immune system stimulating cytokines, for example, IFN-gamma or TNF-a, compared to a reference cell, for example, an unmodified cell similar to the source cell or a U-266 cell;
[00998] [00998] g.expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the endogenous immunostimulatory antigen, for example, Z9g16 or Hormad1, compared to a reference cell, for example, an unmodified cell similar to the source cell, or an A549 cell or an SK-BR-3 cell;
[00999] [00999] h.expression of, for example, expression detectable by a method described herein, HLA-E or HLA-G, compared to a reference cell, for example, an unmodified cell otherwise similar to the cell source or a Jurkat cell;
[001000] [001000] |. surface glycosylation profile, for example, containing sialic acid, which acts, for example, to suppress the activation of NK cells;
[001001] [001001] j. expression less than 50%, 40%, 30%, 20%, 15%, 10% or
[001002] [001002] k. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of ABO blood groups, compared to a reference cell, for example, an unmodified cell otherwise similar to source cell, or a HeLa cell;
[001003] [001003] |. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the Minor Histocompatibility Antigen (MHA), compared to a reference cell, for example, a cell not otherwise modified similar to the source cell or Jurkat cell; or
[001004] [001004] m. has less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of mitochondrial MHAs, compared to a reference cell, for example, a Unmodified cell otherwise, it is similar to the source cell, or a Jurkat cell, or has no detectable mitochondrial MHAs.
[001005] [001005] In the modalities, the co-stimulatory protein is 4-1BB, B7, SLAM, LAG3, HVEM or LIGHT, and the ref cell is HDLM-2. In some embodiments, the co-stimulating protein is BY-H3 and the reference cell is HeLa. In some embodiments, the co-stimulatory protein is ICOSL or B7-H4 and the reference cell is SK-BR-3. In some modalities, the co-stimulating protein is ICOS or OXA40, and the reference cell is MOLT-4. In some embodiments, the co-stimulating protein is CD28 and the reference cell is U-266. In some modalities, the co-stimulating protein is CD30L or CD27, and the reference cell is Daudi.
[001006] [001006] In some embodiments, the fusosome composition does not substantially elicit an immunogenic response by the immune system, for example, the innate immune system. In the modalities
[001007] [001007] In some embodiments, the fusosome composition does not substantially elicit an immunogenic response by the immune system, for example, adaptive immune system. In modalities, an immunogenic response can be quantified, for example, as described here. In some modalities, an immunogenic response by the adaptive immune system comprises an immunogenic response by an adaptive immune cell including, but not limited to, a change, for example, an increase in the number or activity of T lymphocytes (for example , CD4 T cells, CD8 T cells and / or gamma-delta T cells) or B lymphocytes. In some modalities, an immunogenic response by the adaptive immune system includes increased levels of soluble blood components, including, among others , a change, for example, an increase in the number or activity of cytokines or antibodies (for example, IgG, IgM, IgE, IgA or 1gD).
[001008] [001008] In some embodiments, the fusosome composition is modified to have reduced immunogenicity. Immunogenicity can be quantified, for example, as described herein. In some embodiments, the fusosome composition has an immunogenicity less than 5%, 10%, 20%, 30%, 40% or 50% less than the immunogenicity of a reference cell, for example, an unmodified cell of otherwise similar to the source cell or a Jurkat cell.
[001009] [001009] In some embodiments of any of the aspects described herein, the fusosome composition is derived from a cell of origin, for example, a mammalian cell, having a modified genome, for example, modified using a method described herein, to reduce, for example, decrease immunogenicity. Immunogenicity can be quantified, for example, as described herein.
[001010] [001010] In some embodiments, the fusosome composition is derived from an impoverished mammalian cell, for example, with a knockout of one, two, three, four, five, five, six, seven or more of the following items:
[001011] [001011] a. MHC class |, MHC class | l or MHA;
[001012] [001012] b. one or more co-stimulatory proteins, including, but not limited to: LAG3, ICOS-L, ICOS, Ox40L, OX40, CD28, B7, CD30, CD30L 4-1BB, 4-1BBL, SLAM, CD27, CD70, HVEM, LIGHT, B7-H3 or B7-H4;
[001013] [001013] c. soluble immunostimulating cytokines, for example, IFN-gamma or TNF-a;
[001014] [001014] d. endogenous immunostimulatory antigen, for example, Z916 or Hormad1;
[001015] [001015] e.receptors of T cells (TCR);
[001016] [001016] f. Genes that encode ABO blood groups, for example, ABO gene;
[001017] [001017] 9g. transcription factors that drive immune activation, for example, NFKB;
[001018] [001018] h. transcription factors that control MHC expression, for example, class Il transactivator (CIITA), Xbox 5 regulatory factor (RFX5), RFX-associated protein (RFXAP) or ankyrin RFX repeats (RFXANK; also known as RFXB) ; or
[001019] [001019] i. TAP proteins, for example, TAP2, TAP1 or TAPBP, which reduce MHC class | expression.
[001020] [001020] In some embodiments, the fusosome is derived from a cell of origin with a genetic modification that results in increased expression of an immunosuppressive agent, for example, one, two, three or more of the following (for example, in that before the genetic modification the cell does not express the factor):
[001021] [001021] a. surface proteins that suppress the absorption of macrophages, for example, CD47; for example, increased expression of CD47 compared to a reference cell, for example, an unmodified cell similar to the source cell or a Jurkat cell;
[001022] [001022] b. soluble immunosuppressive cytokines, for example, IL-10, for example, increased expression of IL-10 compared to a reference cell, for example, an unmodified cell similar to the parent cell or a Jurkat cell;
[001023] [001023] c. soluble immunosuppressive proteins, for example, PD-1, PD-L1, CTLA4 or BTLA; for example, increased expression of immunosuppressive proteins compared to a reference cell, for example, an unmodified cell similar to the cell source or a Jurkat cell;
[001024] [001024] d.a tolerogenic protein, for example, an ILT-2 or ILT-4 agonist, for example, HLA-E or HLA-G or any other endogenous ILT-2 or ILT-4 agonist, for example example, increased expression of HLA-E, HLA-G, ILT-2 or ILT-4 compared to a reference cell, for example, an unmodified cell similar to the source cell or a Jurkat cell; or
[001025] [001025] e. surface proteins that suppress complement activity, for example, complement regulatory proteins, for example, proteins that bind to the decay accelerating factor (DAF, CD55), for example, protein 1 (FHL-1) similar to factor
[001026] [001026] In some modalities, the increased expression level is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2 times, 3 times, 5 times, 10 times, 20 times, 50 times or 100 times more compared to a reference cell.
[001027] [001027] In some embodiments, the fusosome is derived from a cell of modified origin to have reduced expression of an immune activating agent, for example, one, two, three, four, five, six, seven, eight, eight or more of following:
[001028] [001028] a. less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the MHC class | or MHC class | 1, compared to a reference cell, for example, an unmodified cell that is similar to the source cell or a HeLa cell;
[001029] [001029] b. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of one or more co-stimulating proteins, including but not limited to: LAG3, ICOS-L, ICOS, Ox40L, OX40 , CD28, B7, CD30, CD30L 4-1BB, 4-1BBL, SLAM, CD27, CD70, HVEM, LIGHT, B7-H3 or B7-H4, compared to a reference cell, for example, a non-reference cell modified in another way similar to the source cell or a reference cell described here;
[001030] [001030] c. expression below 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of soluble immune system stimulating cytokines
[001031] [001031] d. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the endogenous immunostimulatory antigen, for example, Z9g16 or Hormad1, compared to a reference cell, for example, a cell not modified in any way similar to the source cell, or an A549 cell or an SK-BR-3 cell;
[001032] [001032] e. less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less expression of T cell receptors (TOR) compared to a reference cell, for example, an unmodified cell otherwise similar to the source cell or Jurkat cell;
[001033] [001033] f. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of ABO blood groups, compared to a reference cell, for example, an unmodified cell otherwise similar to source cell, or a HeLa cell;
[001034] [001034] 9g. expression below 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the transcription factors that trigger immunological activation, for example, NFKB; compared to a reference cell, for example, an unmodified cell similar to the source cell or a Jurkat cell
[001035] [001035] h. expression less than 50%, 40%, 30%, 20%, 15%, 10% or 5% or less of the transcription factors that control MHC expression, for example, class II transactivator (CIITA), regulating factor of Xbox 5 (RFX5), RFX-associated protein (RFXAP) or RFX ankine repeats (RFXANK; also known as RFXB) compared to a reference cell, for example, an unmodified cell otherwise similar to the source cell or a Jurkat cell; or
[001036] [001036] i. expression less than 50%, 40%, 30%, 20%, 15%, 10% or
[001037] [001037] In some embodiments, a fusosome composition derived from a mammalian cell, for example, a mesenchymal stem cell, modified using ShRNA that expresses lentivirus to decrease MHC Class | expression, has lesser expression than MHC Class | compared to an unmodified cell, for example, a mesenchymal stem cell that has not been modified. In some embodiments, a fusosome composition derived from a mammalian cell, for example, a mesenchymal stem cell, modified using lentivirus that expresses HLA-G to increase HLA-G expression, increased HLA-G expression compared to an unmodified cell, for example, a mesenchymal stem cell that has not been modified.
[001038] [001038] In some embodiments, the composition of the fusosome is derived from a cell of origin, for example, a mammalian cell, which is not substantially immunogenic, in which the cells of origin stimulate, for example, to induce the secretion of IFN-gamma T cells, at a level of 0 pg / ml to> 0 pg / ml, for example, as tested in vitro, by the IFN-gamma ELISPOT assay.
[001039] [001039] In some embodiments, the fusosome composition is derived from a parent cell, for example, a mammalian cell, wherein the mammalian cell is from a cell culture treated with an immunosuppressive agent, for example, a glucocorticoid (for example, dexamethasone), cytostatic (for example, methotrexate), antibody (for example, Muromonab-CD3) or immunophilin modulator (for example, Cyclosporine or rapamycin).
[001040] [001040] In some embodiments, the fusosome composition is derived from a cell of origin, for example, a mammalian cell, wherein the mammalian cell comprises an exogenous agent, for example, a therapeutic agent.
[001041] [001041] In some embodiments, the fusosome composition is derived from a cell of origin, for example, a mammalian cell, in which the mammalian cell is a recombinant cell.
[001042] [001042] In some embodiments, the fusosome is derived from a mammalian cell genetically modified to express viral immuno-vasins, for example, hoMV US2 or US11.
[001043] [001043] In some embodiments, the surface of the fusosome, or the surface of the mammalian cell from which the fusosome is derived, is modified covalently or non-covalently with a polymer, for example, a biocompatible polymer that reduces immunogenicity and immunomediated clearance, for example, PEG.
[001044] [001044] In some embodiments, the surface of the fusosome, or the surface of the mammalian cell from which the fusosome is derived, is modified covalently or non-covalently with a sialic acid, for example, a sialic acid comprising glycopolymers, which contain epitopes of NK-suppressing glycans.
[001045] [001045] In some embodiments, the surface of the fusosome or the surface of the mammalian cell from which the fusosome is derived is treated enzymatically, for example, with glycosidase enzymes, for example, a-N-acetylgalactosaminidases, to remove ABO blood groups.
[001046] [001046] In some embodiments, the surface of the fusosome, or the surface of the mammalian cell from which the fusosome is derived, is treated enzymatically, to give rise, for example, to induce the expression of ABO blood groups that correspond to the blood type receiver's guide. PARAMETERS TO ASSESS IMMUNOGENICITY
[001047] [001047] In some embodiments, the fusosome composition is derived from a cell of origin, for example, a mammalian cell that is not substantially immunogenic, or modified, for example, modified using a method described here, to have a reduction in immunogenicity. The immunogenicity of the cell of origin and the composition of the fusosome can be determined by any of the assays described herein.
[001048] [001048] In some embodiments, the composition of the fusosome has an increase, for example, an increase of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more, in graft survival in vivo compared to a reference cell, for example, an unmodified cell otherwise similar to the source cell. In some embodiments, graft survival is determined by an assay that measures graft survival in vivo as described herein, in an appropriate animal model, for example, an animal model described here.
[001049] [001049] In some embodiments, the composition of the fusosome has an increase, for example, an increase of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more in teratoma formation compared to a reference cell, for example, an unmodified cell, otherwise similar to the source cell. In some embodiments, teratome formation is determined by an assay that measures teratome formation, as described here, in an appropriate animal model, for example, in an animal model described herein.
[001050] [001050] In some embodiments, the composition of the fusosome has an increase, for example, an increase of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more in teratome survival compared to a reference cell, for example, an unmodified cell, otherwise similar to the source cell. In some embodiments, the fusosome composition survives for one or more days in a teratoma survival assay. In some embodiments, the survival of the teratroma is determined by an assay that measures the survival of the teratoma as described herein, in an appropriate animal model, for example, in an animal model described herein. In one embodiment, the formation of teratoma is measured by image analysis, for example, IHC staining, fluorescent staining or H&E, of fixed tissue, for example, frozen or fixed in formalin, as described in the Examples. In some embodiments, the fixed tissue can be stained with any or all of the following antibodies: anti-human CD3, anti-human CD4 or anti-human CD8.
[001051] [001051] In some embodiments, the composition of the fusosome has a reduction, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more in the infiltration of CD8 + T cells in a graft or teratoma compared to a reference cell, for example, an unmodified cell similar to the original cell. In one embodiment, the infiltration of CD8 T cells is determined by an assay that measures the infiltration of CD8 + T cells as described here, for example, histological analysis, in an appropriate animal model, for example, an animal model described herein. In some embodiments, teratomas derived from the composition of the fossa have CD8 + T cell infiltration at 0%, 0.1%, 1% 5%, 10%, 20%, 30%, 40% 50%, 60%, 70%, 80%, 90% or 100% of the 50x image fields of a section of histological tissue.
[001052] [001052] In some embodiments, the composition of the fusosome has a reduction, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more in the infiltration of CD4 + T cells into a graft or teratoma compared to a reference cell, for example, an unmodified cell otherwise similar to the source cell. In some embodiments, the infiltration of CD4 T cells is determined by an assay that measures the infiltration of CD4 + T cells as described here, for example, histological analysis, in an appropriate animal model, for example, an animal model described here. In some modalities, teratomas derived from the fusosome composition have infiltration of CD4 + T cells at 0%, 0.1%, 1% 5%, 10%, 20%, 30%, 40% 50%, 60%, 70%, 80%, 90% or 100% of the 50x image fields of a section of histological tissue.
[001053] [001053] In some embodiments, the composition of the fusosome has a reduction, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90% or more in the infiltration of NK CD3 + cells in a graft or teratoma compared to a reference cell, for example, an unmodified cell similar to the original cell. In one embodiment, the infiltration of NK CD3 + cells is determined by an assay that measures the infiltration of NK CD3 + cells as described here, for example, histological analysis, in an appropriate animal model, for example, an animal model described herein. In some modalities, teratomas derived from the fusosome composition have infiltration of NK CD3 + T cells at 0%, 0.1%, 1% 5%, 10%, 20%, 30%, 40% 50%, 60% , 70%, 80%, 90% or 100% of the 50x image fields of a section of histological tissue.
[001054] [001054] In some embodiments, the fusosome composition has a reduction in immunogenicity, measured by a reduction in the humoral response after one or more implantation of the fusosome derived from an appropriate animal model, for example, an animal model described here, in comparison with a humoral response after one or more implantation of a reference cell, for example, an unmodified cell similar to the original cell, in an animal model
[001055] [001055] In some embodiments, the fusosome composition has a reduction in phagocytosis of macrophages, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 90% or more in macrophage phagocytosis compared to a reference cell, for example, an unmodified cell similar to the source cell, in which the reduction in macrophage phagocytosis is determined by analyzing the in vitro phagocytosis index, for example, as described in Example 82. In some embodiments, the fusosome composition has a phagocytosis index of O, 1, 10, 100 or more, for example, as measured by an assay of Example 82, when incubated with macrophages in an in vitro macrophage phagocytosis assay.
[001056] [001056] In some modalities, the cell of origin has a reduction in cell lysis mediated by cytotoxicity by PBMCs, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50 %, 60%,
[001057] [001057] In some embodiments, the composition of the fusosome has a reduction in cell lysis mediated by NK, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in NK-mediated cell lysis compared to a reference cell, for example, an unmodified cell similar to the source cell, in which NK-mediated cell lysis is tested in vitro, by a chromium release test or europium release test.
[001058] [001058] In some embodiments, the composition of the fusosome has a reduction in cell lysis mediated by CD8 + T cells, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in cell lysis mediated by CD8 T cells compared to a reference cell, for example, an unmodified cell similar to the source cell, in which cell lysis measures - CD8 T cell ada is tested in vitro by a chromium release assay or europium release assay. In the embodiments, activation and / or proliferation is measured as described in Example 85.
[001059] [001059] In some embodiments, the composition of the fusosome has a reduction in the proliferation and / or activation of CD4 + T cells, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50 %, 60%, 70%, 80%, 90% or more compared to a reference cell, for example, an unmodified cell similar to the source cell, in which CDA4 T cell proliferation is tested in vitro (eg modified or unmodified mammalian co-culture assay source cell and CD4 + T cells with Dynabeads
[001060] [001060] In some embodiments, the composition of the fusosome has a reduction in the secretion of IFN-gamma T cells, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 90% or more in the IFN-gamma secretion of T cells compared to a reference cell, for example, an unmodified cell similar to the source cell, in which secretion of I | IFN-gamma T cells is tested in vitro, for example, by IFN-gamma ELISPOT.
[001061] [001061] In some embodiments, the fusosome composition has a reduction in the secretion of immunogenic cytokines, for example, a reduction of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in the secretion of immunogenic cytokines in comparison with a reference cell, for example, an unmodified cell similar to the source cell, in which the secretion of immunogenic cytokines is tested in vitro using ELISA or ELISPOT.
[001062] [001062] In some embodiments, the composition of the fusosome results in increased secretion of an immunosuppressive cytokine, for example, an increase of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90% or more in the secretion of an immunosuppressive cytokine compared to a reference cell, for example, an unmodified cell similar to the source cell, in which the secretion of the immunosuppressive cytokine is tested in vitro using ELISA or ELISPOT.
[001063] [001063] In some embodiments, the fusosome composition has an increase in the expression of HLA-G or HLA-E, for example, an increase in the expression of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of HLA-G or HLA-E, compared to a reference cell, for example, an unmodified cell similar to the source cell, in that the expression of HLA-G or
[001064] [001064] In some embodiments, the composition of the fusosome has an increase in the expression of T cell inhibitory ligands (for example, CTLA4, PD1, PD-L1), for example, an increase in expression of 1%, 5% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of T cell inhibitor ligands compared to a reference cell, for example, a cell not modified in another way similar to the source cell, in which the expression of the T cell inhibitor the ligands are tested in vitro using flow cytometry, for example, FACS.
[001065] [001065] In some embodiments, the composition of the fusosome has a decrease in the expression of co-stimulatory ligands, for example, a decrease of 1%, 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 90% or more in the expression of costimulatory ligands compared to a reference cell, for example, an unmodified cell similar to the source cell, in which the expression of ligands Co-stimulators are tested in vitro using flow cytometry, for example, FACS.
[001066] [001066] In some embodiments, the composition of the fusosome has a decrease in the expression of the MHC class | or MHC class Il, for example, a decrease in expression of 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of MHC Class | or MHC Class | l compared to a reference cell, for example, an unmodified cell similar to the source cell or a HeLa cell, in which the MHC Class | or | l is tested in vitro using flow cytometry, for example, FACS.
[001067] [001067] In some embodiments, the fusosome composition is derived from a cell source, for example, a mammalian cell source, which is substantially non-immunogenic. In some modalities, immunogenicity can be quantified, for example, as described here. In some embodiments, the mammalian cell source comprises any, all, or a combination of the following resources:
[001068] [001068] a.in which the source cell is obtained from an autologous cell source; for example, a cell obtained from a recipient who will receive, for example, administered, the fusosome composition;
[001069] [001069] b.in which the source cell is obtained from an allogeneic cell source that has a similar gender, for example, similar to a recipient, for example, a recipient described here that will be receiving, for example , administered; the fusosome composition;
[001070] [001070] c.in which the source cell is obtained is from an allogeneic cell source that corresponds to the HLA that corresponds to the HLA of a recipient, for example, in one or more alleles;
[001071] [001071] d.in which the source cell is obtained is from an allogeneic cell source that is an HLA homozygote;
[001072] [001072] e. where the source cell is obtained is from an allogeneic cell source that does not have (or has low levels compared to a reference cell) MHC class | and Il; or
[001073] [001073] f. where the source cell is obtained is from a cell source that is known to be substantially non-immunogenic, including, but not limited to, a stem cell, a mesenchymal stem cell, an induced pluripotent stem cell, an embryonic stem cell, a Sertoli cell or a retinal pigment epithelial cell.
[001074] [001074] In some embodiments, the subject to be administered the fusosome composition has or is known to have or is tested for a pre-existing antibody (for example, IgG or IgM) reactive with a fusosome. In some embodiments, the subject to be administered the fusosome composition does not have detectable levels of a pre-existing fusosome-reactive antibody. Tests for the antibody are described, for example, in Example 78.
[001075] [001075] In some embodiments, a subject who has received the fusosome composition has or is known to have or is tested for an antibody (for example, IgG or IgM) reactive with a fusosome. In some embodiments, the subject who received the fossa composition (for example, at least once, twice, three times, four times, five times or more) has no detectable levels of antibody reactive with the fusosome. In modalities, antibody levels do not increase by more than 1%, 2%, 5%, 10%, 20% or 50% between two points in time, the first point in time before the first administration of the fusosome and the second point in time. after one or more administrations of the fusosome. Tests for the antibody are described, for example, in Example 79. ADDITIONAL THERAPEUTIC AGENTS
[001076] [001076] In some embodiments, the fusosome composition is co-administered with an additional agent, for example, a therapeutic agent, to a subject, for example, a receptor, for example, a receptor described herein. In some embodiments, the coadministered therapeutic agent is an immunosuppressive agent, for example, a glucocorticoid (for example, dexamethasone), cytostatic (for example, methotrexate), antibody (for example, Muromonab-CD3) or immunophilin modulator. (for example, Cyclosporine or rapamycin). In the modalities, the immunosuppressive agent decreases the immune clearance mediated by fusosomes. In some embodiments, the fusosome composition is co-administered with an immunostimulating agent, for example, an adjuvant, an interleukin, a cytokine or a chemokine.
[001077] [001077] In some embodiments, the fusosome composition and the immunosuppressive agent are administered at the same time, for example, administered in a contemporary manner. In some modalities, the fusosome composition is administered prior to administration of the immunosuppressive agent. In some embodiments, the fusosome composition is administered after administration of the immunosuppressive agent.
[001078] [001078] In some embodiments, the immunosuppressive agent is a small molecule, such as ibuprofen, acetaminophen, cyclosporine, tacrolimus, rapamycin, mycophenolate, cyclophosphamide, glucocorticoids, sirolimus, azatrriopine or methotrexate.
[001079] [001079] In some embodiments, the immunosuppressive agent is an antibody molecule, including, but not limited to: muronomab (anti-CD3), daclizumab (anti-IL12), Basiliximab, Infliximab (Anti-TNFa) or rituximab (Anti-CD20).
[001080] [001080] In some embodiments, co-administration of the fusosome composition with the immunosuppressive agent results in improved persistence of the fusosome composition in the subject compared
[001081] [001081] In some embodiments, a fusogen (for example, protein, lipid or chemical fumogen) or a fusogen binding partner is delivered to a target cell or tissue before, at the same time, or after delivery of a fusosome.
[001082] [001082] In some modalities, a fusogen (for example, protein, lipogen or chemical fusogen) or a fusogen binding partner is delivered to a non-target cell or tissue before, at the same time or after the delivery of a fusosome.
[001083] [001083] In some embodiments, a nucleic acid encoding a fusogen (eg, lipid or protein fusogen) or a fusogen binding partner is delivered to a target cell or tissue before, at the same time, or after delivery of a fusosome.
[001084] [001084] In some embodiments, a polypeptide, nucleic acid, ribonucleoprotein or small molecule that upregulates or decreases the expression of a fusogen (for example, protein, lipogen or chemical fusogen) or a fusogen binding partner is delivered to a target cell or tissue before, at the same time, or after the delivery of a fusosome.
[001085] [001085] In some embodiments, a polypeptide, nucleic acid, ribonucleoprotein or small molecule that upregulates or decreases the expression of a fusogen (for example, protein, lipogen or chemical fusogen) or a fusogen binding partner is delivered to a non-target cell or tissue before at the same time or after the delivery of a fusosome.
[001086] [001086] In some embodiments, the target cell or tissue is modified by (for example, inducing stress or cell division) to increase the fusion rate before, at the same time or after the delivery of a fusosome. Some non-limiting examples include, ischemia induction, chemotherapy treatment, antibiotics, irradiation, toxin, inflammation, inflammatory molecules, anti-inflammatory molecules, acid injury, basic injury, burn, polyethylene glycol, neurotransmitters, myelotoxic drugs, growth factors or hormones, tissue resection, hunger and / or exercise.
[001087] [001087] In some embodiments, the target cell or tissue is treated with a vasodilator (for example, nitric oxide (NO), carbon monoxide, prostacyclin (PGI2), nitroglycerin, phentolamine) or vasoconstrictors (for example, angiotensin (AGT), endothelin (EDN), norepinephrine)) to increase the transport rate from the fusosome to the target tissue.
[001088] [001088] In some embodiments, the target cell or tissue is treated with a chemical agent, for example, a chemotherapeutic agent. In such modalities, chemotherapy induces damage to the target cell or tissue that increases the fusogenic activity of the target cells or tissue.
[001089] [001089] In some modalities, the target cell or tissue is treated with physical stress, for example, electrofusion. In such modalities, physical stress destabilizes the membranes of the target cell or tissue to increase the fusogenic activity of the target cells or tissue.
[001090] [001090] In some embodiments, the target cell or tissue can be treated with an agent to improve fusion with a fusosome. For example, specific neuronal receptors can be stimulated with an antidepressant to improve fusogenic properties.
[001091] [001091] The compositions comprising the fusosomes described herein may be administered or directed to the circulatory system, liver system, renal system, cardiopulmonary system, central nervous system, peripheral nervous system, musculoskeletal system, lymphatic system, immune system, sensitive nervous system (sight, hearing, smell, touch, taste), digestive system, endocrine systems (including metabolic regulation of adipose tissue) and reproductive system.
[001092] [001092] In the embodiments, a fusosome composition described herein is delivered ex vivo to a cell or tissue, for example, a human cell or tissue. In some embodiments, the composition is delivered to an ex vivo tissue that is in an injured state (for example, from trauma, illness, hypoxia, ischemia or other damage).
[001093] [001093] In some embodiments, the fusosome composition is delivered to an ex vivo transplant (for example, a tissue or tissue explant for transplant, for example, a human vein, a musculoskeletal graft, such as bone or tendon, cornea , skin, heart valves, nerves, or an isolated or cultured organ, for example, an organ to be transplanted into a human eg a human heart, liver, lung, kidney, pancreas, intestine, thymus, eye) . The composition improves the viability, breathing or other function of the transplant. The composition can be delivered to the tissue or organ before, during and / or after the transplant.
[001094] [001094] In some embodiments, a fusosome composition described herein is delivered ex vivo to a cell or tissue derived from a subject. In some embodiments, the cell or tissue is readministered to the subject (that is, the cell or tissue is autologous).
[001095] [001095] Fusosomes can fuse with a cell of any mammalian tissue (for example, human), for example, tissue
[001096] [001096] In the modalities, the fusosome targets a tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, peripheral nervous system , skeletal muscle, endothelium, inner ear, adipose tissue (for example, brown adipose tissue or white adipose tissue) or eye, when administered to a subject, for example, in which at least 0.1%, 0.5% , 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the fusosomes in a population of administered fusosomes are present in the target tissue after 24, 48 or 72 hours, for example, by an Example 87 or 100 assay.
[001097] [001097] In modalities, fusosomes can fuse with a cell from a source of stem cells or parental cells, for example, bone marrow stromal cells, adult parental cells derived from the marrow (MAPCs), parental cells endothelial cells (EPC),
[001098] [001098] In certain respects, the description provides a method of delivering a closed membrane preparation to a target cell in a subject. In some embodiments, the method comprises administering to a subject a fusosome, for example, a membrane-wrapped preparation comprising a nucleic acid encoding a fusogen, for example, a myomaterial protein, in which the nucleic acid is not present. present or not expressed (for example, it is present but not transcribed or translated) within a cell, under conditions that allow the fusogen to be expressed on the subject's fusosome surface. In some embodiments, the method further comprises administering to the subject a composition comprising an agent, for example, a therapeutic agent and a fusogen binding partner, optionally comprising a carrier, for example, a membrane, under conditions that it allows fusion of the fusogen into the fusosome and the fusogen binding partner. In some embodiments, the carrier comprises a membrane, for example, a lipid bilayer, for example, the agent is disposed within a lipid bilayer. In some modalities, the lipid bilayer fuses with the target cell, thus delivering the agent to the target cell in the subject.
[001099] [001099] In one embodiment, a fusogen-binding partner is a fraction, for example, a protein molecule, arranged on a membrane (for example, a lipid bilayer), of a target cell, for example, a cell target disclosed here. In one embodiment, the membrane can be a cell surface membrane or a subcellular membrane of an organelle, for example, a mitochondria, lysosome or Golgi apparatus. In one embodiment, the fusogen binding partner can be expressed endogenously or exogenously (for example, by a method described here). In one embodiment, the fusogen binding partner can group with other fusogen binding partners on the membrane.
[001100] [001100] In one embodiment, the presence of a fusogen binding partner, or a plurality of fusogen binding partners, in a membrane of a target cell, creates an interface that can facilitate interaction, for example, bond, between a fusogen binding partner in a target cell (for example, a cell described here) and a fusogen in a fusosome (for example, a fososome described here). In some embodiments, the fusogen in a fusosome interacts with, for example, it binds to a fusogen binding partner in the target cell, for example, in the membrane (for example, lipid bilayer) of a target cell, to induce fusion of the fusosome with the target membrane. In some embodiments, fumogen interacts with, for example, it binds to a fusogen binding partner on a landing pad in a subcellular organelle, including a mitochondria, to induce fusion of the spindle-sum with the subcellular organelle .
[001101] [001101] A fusogen binding partner can be introduced into a target cell, for example, a target cell disclosed here, by any of the methods discussed below.
[001102] [001102] In one embodiment, a method of introducing a fusogen-binding partner to a target cell comprises removing, for example, extracting a target cell (for example, by apheresis or biopsy ) of a subject (e.g., a subject described herein) and administering, for example, exposure to a fusogen-binding partner under conditions that allow the fusogen-binding partner to be expressed on a target cell membrane. In one embodiment, the method further comprises contacting the target cell that expresses a fusogen binding partner ex vivo with a fososome comprising a fusogen to induce fusion of the spindle-sum with the membrane of the target cell. In one embodiment, the target cell fused to the fusosome is reintroduced into the subject, for example, intravenously.
[001103] [001103] In one embodiment, the target cell that expresses a fusogen binding partner is reintroduced into the subject, for example, intravenously. In one embodiment, the method further comprises administering to the subject a fusosome comprising a fusogen to allow interaction, for example, binding, of the fusogen in the spindle-sum with the fusogen binding partner in the target cell and fusion of the fusosome with the membrane of the target cell.
[001104] [001104] In some embodiments, the target cells are treated with an epigenetic modifier, for example, a small molecule epigenetic modifier, to increase or decrease the expression of an endogenous cell surface molecule, for example, a binding partner to fusogen, for example, a target organ, tissue or molecular cell, where the cell surface molecule is a protein, glycan, lipid or low molecular weight molecule. In one embodiment, the target cell is genetically modified to increase the expression of an endogenous molecule on the cell surface, for example, a fusogen binding partner, for example, a cell targeting organ, tissue, or molecule, where cell surface molecule is a protein, glycan, lipid molecule or low molecular weight. In one embodiment, genetic modification can decrease the expression of an activator of the transcription of the endogenous molecule on the cell surface, for example, a fusogen-binding partner.
[001105] [001105] In one embodiment, the target cell is genetically modified to express, for example, overexpression, an exogenous cell surface molecule, for example, a fusogen binding partner, in which the cell surface molecule is a protein molecule, glycan, lipid or low molecular weight.
[001106] [001106] In some embodiments, the target cell is genetically modified to increase the expression of an exogenous fusogen in the cell, for example, delivery of a transgene. In some modalities, a nucleic acid, for example, DNA, mRNA or siRNA, is transferred to the target cell, for example, to increase or decrease the expression of a cell surface molecule (protein, glycan, lipid or low molecular weight molecule). In some modalities, the nucleic acid targets a repressor from a fusogen-binding partner, for example, a sShRNA or siRNA construct. In some embodiments, the nucleic acid encodes an inhibitor of a fusogen-binding partner repressor. METHODS OF USE
[001107] [001107] The administration of a pharmaceutical composition described herein can be oral, inhaled, transdermal or parenteral (including intravenous, intratumoral, intraperitoneal, intramuscular, intraperitoneal and subcutaneous administration). Fusosomes can be administered alone or formulated as a pharmaceutical composition
[001108] [001108] Fusosomes can be administered in the form of a unit dose composition, such as an oral, parenteral, transdermal or inhaled unit dose composition. Such compositions are prepared by mixing and are suitably adapted for oral, inhaled, transdermal or parenteral administration and, as such, can be in the form of tablets, capsules, oral liquid preparations, powders, granules, lozenges, reconstitutable powders, injectable solutions and inedible or suspensions or suppositories or aerosols.
[001109] [001109] In some embodiments, delivery of a fusosome composition described herein may induce or block differentiation, de-differentiation or trans differentiation. The target mammalian cell can be a precursor cell. Alternatively, the target mammalian cell can be a differentiated cell and the change in cell destiny includes de-differentiation into a pluripotent precursor cell or blocking this de-differentiation. In situations where a change in cell fate is desired, effective amounts of a spindle sum described here that encode a molecule or signal inducing cell fate are introduced into a target cell under conditions such that a change in cell fate is induced. In some modalities, a fusosome described here is useful for reprogramming a subpopulation of cells from a first phenotype to a second phenotype. This reprogramming can be temporary or permanent. Optionally, reprogramming induces a target cell to adopt an intermediate phenotype.
[001110] [001110] Methods are also provided to reduce cell differentiation in a target cell population. For example, a target cell population containing one or more types of precursor cells is brought into contact with a fusosome composition described herein, under conditions such that the composition reduces differentiation of the precursor cell. In certain embodiments, the target cell population contains tissue injured in a mammal or tissue affected by a surgical procedure. The precursor cell is, for example, a stroma precursor cell, a neural precursor cell or a mesenchymal precursor cell.
[001111] [001111] A fusosome composition described herein, comprising a charge, can be used to deliver that charge to a cellular tissue or subject. Delivery of a charge by administering a fusosome composition described herein can modify levels of cellular protein expression. In certain embodiments, the administered composition directs positive regulation (via expression in the cell, delivery to the cell or induction into the cell) of one or more charges (for example, a polypeptide or mRNA) that provide substantially functional activity absent or reduced in the cell in which the polypeptide is delivered. For example, the increased functional activity may be of an enzymatic, structural or regulatory nature. In related modalities, the administered composition directs the positive regulation of one or more polypeptides that increase (for example, synergistically) a functional activity that is present but substantially deficient in the cell in which the polypeptide is up-regulated. In certain modalities, the composition administered directs the negative regulation (via expression in the cell, delivery to the cell or induction within the cell) of one or more charges (for example, a polypeptide, siRNA or miRNA) that repress an activity functional that is present or is regulated in the cell in which the polypeptide, siRNA or miRNA is delivered. For example, excess regulated functional activity may be of an enzymatic, structural or regulatory nature. In related modalities, the administered composition directs the negative regulation of one or more polypeptides that decrease (for example, synergistically) a funda- mental activity.
[001112] [001112] In modalities, the fusosome composition (for example, one that comprises mitochondria or DNA) mediates an effect on a target cell and the effect lasts at least 1, 2, 3, 4, 5, 6 or 7 days, 2, 3, or 4 weeks or 1, 2, 3, 6, or 12 months. In some embodiments (for example, in which the fusosome composition comprises an exogenous protein), the effect lasts less than 1, 2, 3, 4, 5, 6 or 7 days, 2, 3 or 4 weeks or 1, 2, 3, 6 or 12 months. EX VIVO APPLICATIONS
[001113] [001113] In embodiments, the fusosome composition described herein is delivered ex vivo to a cell or tissue, for example, a human cell or tissue. In the embodiments, the composition improves the function of a cell or tissue ex vivo, for example, it improves cell viability, respiration or another function (for example, another function described here).
[001114] [001114] In some embodiments, the composition is delivered to an ex vivo tissue that is in an injured state (for example, from trauma, illness, hypoxia, ischemia or other damage).
[001115] [001115] In some embodiments, the composition is delivered to an ex vivo transplant (for example, a tissue or tissue explant for transplant, for example, a human vein, a musculoskeletal graft, such as bone or tendon, cornea, skin , heart valves, nerves, or an isolated or cultured organ, for example, an organ to be transplanted into a human, for example, a human heart, liver, lung, kidney, pancreas, intestine, thymus, eye). The composition can be delivered to the tissue or organ before, during and / or after transplantation.
[001116] [001116] In some modalities, the composition is delivered, administered
[001117] [001117] The fusosome compositions described herein can be administered to a subject, for example, a mammal, for example, a human. In such modalities, the subject may be at risk of, may have a symptom of, or may be diagnosed or identified as having a specific disease or condition (for example, a disease or condition described herein).
[001118] [001118] In some embodiments, the source of fusosomes is from the same subject who is administered a fusosome composition. In other modalities, they are different. For example, the source of fusosomes and recipient tissue can be autologous (from the same subject) or heterologous (from different subjects). In either case, the donor tissue for the fusosome compositions described here may be a different type of tissue than the recipient tissue. For example, the donor tissue may be muscle tissue and the recipient tissue may be connective tissue (for example, adipose tissue). In other embodiments, the donor tissue and the recipient tissue may be of the same or a different type, but come from different organ systems.
[001119] [001119] A fusosome composition described herein can be administered to a subject with a cancer, an autoimmune disease, an infectious disease, a metabolic disease, a neurodegenerative disease, or a genetic disease (for example, enzyme deficiency bad). In some modalities, the subject needs regeneration.
[001120] [001120] In some embodiments, the fusosome is co-administered with an inhibitor of a protein that inhibits membrane fusion. For example, Suppressyn is a human protein that inhibits cell-cell fusion (Sugimoto et al., "A novel human endogenous retroviral protein inhibits cell-cell fusion" Scientific Reports 3: 1462 DOI:
[001121] [001121] The compositions described herein can also be used to similarly modulate the function or physiology of cells or tissues of a variety of other organisms, including, but not limited to, farm or working animals (horses, cows, pigs, ga - lines etc.), pets or zoo animals (cats, dogs, lizards, birds, lions, tigers and bears etc.), farm animals (fish, crabs, shrimp, oysters etc.), species of plants (trees, plantations, ornamental flowers, etc.), species of fermentation (saccharomyces, etc.). The fusosome compositions described herein can be made from non-human sources and administered to a target non-human cell, tissue or subject.
[001122] [001122] Fusosome compositions can be autologous, allogeneic or xenogenic to the target.
[001123] [001123] All references and publications cited herein are incorporated by reference.
[001124] [001124] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention; it will be understood by its exemplary nature that other procedures, methodologies or techniques known to those skilled in the art can be used alternatively.
[001125] [001125] HeLa donor cells expressing Mito-DsRed (a specific target dye in the mitochondria) were trypsinized with 0.25% trypsin, collected, spun at 500xg for 5min, washed once in PBS and counted. 10x10% 6 cells were subsequently resuspended in 3 ml of 12.5% ficoll in MEM-complete alpha (+ 10% FBS, + 1% penicillin / streptomycin, + glutamine) supplemented with 10 ug / ml cytocalasin- B for 15 min. To enuclear cells, they were transferred to a discontinuous ficoll gradient, consisting of the following ficoll fractions (top to bottom): 2 ml! 12.5% ficoll, 0.5 ml 15% ficoll, 0.5 ml 16% ficoll, 2 ml 17% ficoll gradient, 2 ml! 25% ficoll. All ficoll gradient fractions were made in complete DMEM supplemented with 10 µg / ml! of cytohalasin-B. The gradients were centrifuged in a Beckman SW-40 ultra-centrifuge, Ti-70 rotor at 107971xg for 1h at 37ºC. After centrifugation, enucleated HeLa cells were collected from 12.5%, 15%, 16% and 1/2 of the 17% phyllotic fractions and resuspended in complete DMEM (+ 10% SFB, + 1% penicilli - in / streptomycin, + glutamine) and rotated at 500xg for 5 minutes to granulate. Enucleated Mito-DsRed donor cells were washed 2x in DMEM. At the same time, the recipient HeLa cells that express Mito-GFP (a specific target dye from the mitochondria) were trypsinized, counted and prepared for fusion.
[001126] [001126] For the fusion, the enucleated donor HeLa Mito-DsRed cells were combined in a 1: 1 ratio with HeLa Mito-GFP receptor cells (200,000 each) in a 50% polyethylene glycol solution (PEG 50% w / v prepared in complete DMEM with 10% DMSO) for 1 minute at 37ºC. The cells were subsequently washed 3X in 10 ml of complete DMEM and plated on 35 mm glass bottom quadrant image plates at a density of 50k cells / quadrant, with each quadrant having an area of 1.9 cm2. EXAMPLE 2. GENERATION OF NUCLEA FUSOGENIC CELLS BY CHEMICAL TREATMENT (PEG)
[001127] [001127] HeLa donor cells expressing Mito-DsRed (a specific target dye from the mitochondria) were trypsinized with 0.25% trypsin, collected, spun at 500xg for 5min, washed once in PBS and counted. 2x106 cells were subsequently resuspended in complete DMEM (+ 10% FBS, + 1% penicillin / streptomycin, + glutamine), counted and prepared for fusion.
[001128] [001128] Mito-DsRed donor cells were washed 3x in DMEM. Simultaneously, the HeLa receptor cells expressing Mito-GFP (a specific target dye from the mitochondria) were trypsinized, counted and prepared for fusion.
[001129] [001129] For fusion, Mito-DsRed donor HeLa cells were combined in a 1: 1 ratio with Mito-GFP recipient HeLa cells (200,000 each) in a 50% polyethylene glycol solution (50% PEG per w / v prepared in complete DMEM with 10% DMSO) for 1 minute at 37ºC. The cells were subsequently washed 3X in 10 ml of complete DMEM and plated on 35 mm glass bottom quadrant image plates at a density of 50K cells / quadrant, with each quadrant having an area of 1.9 cm2.
[001130] [001130] This example describes the creation of tissue culture cells that express an exogenous fusogen. The following example is equally applicable to any protein-based fusogen and is equally applicable to production in primary cells (in suspension or adherent) and tissue. In certain cases, a fusogen pair can be used to induce fusion (outlined as a fusogen and a fusogen binding partner).
[001131] [001131] The fusogen gene, fusion failure 1 (EFF-1), is cloned into the vector plIlRES2-AcGFP1 (Clontech), and this construct is then transfected into HeLa cells (CCL-2 "", ATCC) using transfection reagent Lipofectamine 2000 (Invitrogen). The fusogen binding partner gene, which fails to fuse anchor 1 cells (AFF-1), is cloned into the plRES2 vector DsRed-Express 2 (Clontech) and this construct is then transfected into HeLa cells (CCL-2TM , ATCC) using the Lipofectamine 2000 Transfection Reagent (Invitrogen). The transfected HeLa cells are maintained at 37ºC, CO 5% in Dulbecco's modified Eagle medium (DMEM) supplemented with GlutaMAX (GIBCO), 10% fetal calf serum (GIBCO) and 500 mg / ml zeocin. Cells that express EFF-1 are isolated by fluorescence activated cell classification (FACS) to obtain a pure population of GFP + Hela cells that express the EFF-1 fusogen. Cells expressing AFF-1 are isolated by fluorescence activated cell classification (FACS) to obtain a pure population of DSRED + Hela cells that express the AFF-1 fusion-binding partner. EXAMPLE 4. DELIVERY OF ORGANELES THROUGH CELLS CHEMICALLY ENHANCED FUSOGENIC ENUCLEATES
[001132] [001132] Fusogenic cells (enucleated cells from the Myro-
[001133] [001133] Organelle delivery fusion events were identified based on the criteria that> 50% of mitochondria (identified by all pixels that are myth-GFP + or myth-Ds-Red +) in a cell were positive for mitoDs-Red and mito-GFP based on the threshold indicated above, indicating that the organelles (in this case mitochondria) containing these proteins were delivered, fused and their contents mixed. Within 24 hours, several cells exhibited positive delivery of organelles by fusion, as shown in Figure
[001134] [001134] Fusogenic cells (Mito-DsRed donor cells and Mito-GFP recipient HeLa cells) produced and combined as described in example 2 were photographed in a Zeiss LSM 780 inverted confocal microscope with 63X magnification 24 hours after de - position on the image plate. Cells that express only Mito-DsRed alone and Mito-GFP alone were photographed separately to configure the acquisition settings to ensure that there is no signal overlap between the two channels under conditions in which Mito-DsRed and Mito-GFP were present and acquired simultaneously. Ten regions of interest were chosen in a completely impartial manner, with the sole criterion that a minimum of cells was contained in each ROI, so that a minimum of 100 cells were available for analysis downstream. It was determined that a given pixel in these images was positive for mitochondria if the intensity for any channel (myth-DsRed and myth-GFP) was greater than 20% of the maximum intensity value for each respective channel in the three ROIs.
[001135] [001135] Organelle delivery fusion events were identified based on the criteria that> 50% of mitochondria (identified by all pixels that are myth-GFP + or myth-Ds-Red +) in a cell were positive for mitoDs-Red and mito-GFP based on the threshold indicated above, indicating that the organelles (in this case mitochondria) containing these proteins were delivered, fused and their contents mixed. Within 24 hours, several cells exhibited positive delivery of organelles by fusion, as shown in Figure
[001136] [001136] Fusogenic cells produced and combined as described in Example 3 are photographed in a Zeiss LSM 780 inverted confocal microscope with 63X magnification 24h after deposition on the image plate. Cells that express only Mito-DsRed alone and Mito-GFP alone are recorded separately to define acquisition settings to ensure that there is no signal overlap between the two channels under conditions where Mito-DsRed and Mito-GFP are present and acquired simultaneously. Ten regions of interest are chosen in a completely impartial manner, with the only criteria being that a minimum of 10 cells is contained in each ROI, so that a minimum number of cells is available for analysis downstream. A given pixel in these images is determined to be positive for mitochondria if the intensity of any channel (myth-DsRed and myth-GFP) is greater than 10% of the maximum intensity value for each respective channel in the three ROIs.
[001137] [001137] Organelle delivery fusion events will be identified based on the criteria that> 50% of mitochondria (identified by all pixels that are myth-GFP + or myth-Ds-Red +) in a cell are positive for mitoDs-Red and mito-GFP based on the threshold indicated above, which will indicate that the organelles (in this case mitochondria) containing these proteins are delivered, fused and their contents mixed. Within 24 hours, several cells are expected to exhibit positive organelle delivery by fusion. EXAMPLE 7: ELECTROPORA GENERATION OF FUSOSOMES NUCLEIC ACID
[001138] [001138] This example describes the generation of fusosomes by
[001139] [001139] Transposase vectors (System Biosciences, Inc.) that include the open reading frame of the Puromycin resistance gene along with an open reading frame of a cloned fragment (eg, stomatitis virus glycoprotein vesicular [VSV-G], Oxford Genetics tt OG592) are electroporated in 293Ts using an electroporator (Amaxa) and a nuclear transfection kit specific for the 293T cell line (Lonza).
[001140] [001140] After selection with 1 ug / ul of puromycin for 3 to 5 days in DMEM containing 20% fetal bovine serum and 1x penicillin / streptomycin, the cells are washed with 1xPBS, cold lysis buffer (150 mM NaCl, 0.1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCI, pH 8.0 and protease inhibitor cocktail (Abcam, ab201117)), sonicated 3 times, 10 to 15 seconds per time and centrifuged at 16,000 xg for 20 minutes. A western blot is conducted on the supernatant fraction recovered with a VSV-G specific probe to determine the specific non-membrane VSV-G concentration of fusosomes prepared from stably transfected cells or control cells and compared to the VSV- G protein.
[001141] [001141] In modalities, fusosomes from stably transfected cells will have more VSV-G than fusosomes generated from cells that have not been stably transfected. EXAMPLE 8: ELECTROPORA GENERATION OF FUSOSOMES PROTEINS
[001142] [001142] This example describes electroporation of fusogens to generate fusosomes.
[001143] [001143] Approximately 5 x 10 th cells or vesicles are used for electroporation using a trans electroporation system
[001144] [001144] See, for example, Liang et al., High efficiency and rapid mammalian cell engineering via protein transfection Cas9, Journal of Biotechnology 208: 44 to 53, 2015. EXAMPLE 9: FUSOSOMES GENERATION AND ISOLATION ATRA - VESICLE FORMATION AND CENTRIFUGATION
[001145] [001145] This example describes the generation and isolation of spindles-sum via vesiculation and centrifugation. This is one of the methods by which fusosomes can be isolated.
[001146] [001146] Fusosomes are prepared as follows. Approximately 4 x 10 6 HEK-293T cells are seeded on a 10 cm plate in complete medium (DMEM + 10% FBS + Pen / Strep). One day after sowing, 15 µg of plasmid or virus that expresses the fusogen is delivered to the cells. After a sufficient period of time for the expression of the fusogen, the medium is carefully replaced with fresh medium supplemented with 100 µM of ATP. The supernatants are harvested 48 to 72 hours after the expression of the fusogen, clarified by filtration through a 0.45 µm filter and ultracentrifu-
[001147] [001147] See, for example, Mangeot et al., Molecular Therapy, vol. 19 no. 9, 1656 to 1666, September 2011 EXAMPLE 10: GENERATION AND ISOLATION OF FUSOSOMES Gl- PLASMATIC MEMBRANE GANTES
[001148] [001148] This example describes the generation and isolation of spindles-sum via vesiculation and centrifugation. This is one of the methods by which fusosomes can be isolated. Fusosomes are prepared as follows.
[001149] [001149] Briefly, HeLa cells expressing a spindle are washed twice in buffer (10 mM HEPES, 150 mM NaCl, 2 mM CaCl2, pH 7.4), resuspended in a solution (1 mM of DTT, 12.5 mM paraformaldehyde and 1 mM N-ethylmaleimide in GPMV buffer) and incubated at 37ºC for 1 h. Fusosomes are cleared from the cells, first removing the cells by centrifugation at 100 xg for 10 minutes and then collecting the fusosomes at 20,000 xg for 1 h at 4ºC. Fusosomes are resuspended in the desired buffer for experimentation.
[001150] [001150] See, for example, Sezgin E et al. Elucidating membrane structure and protein behavior using giant membrane plasma vesicles. Nat. Protocols. 7 (6): 1042 to 1051, 2012. EXAMPLE 11: GENERATION AND ISOLATION OF FUH GHOST SOSOMES
[001151] [001151] This example describes the generation and isolation of spindles by means of hypotonic treatment and centrifugation. This is one of the methods by which fusosomes can be produced.
[001152] [001152] First, fusosomes are isolated from mesenchymal stem cells that express fusogens (10th cells), mainly
[001153] [001153] To avoid adherence, fusosomes are placed in plastic tubes and centrifuged. A laminated granule is produced in which the upper end of the lighter gray sheet includes mainly fusosomes. However, the whole granule is processed to increase yields. Centrifugation (for example, 3,000 rpm for 15 min at 4 ° C) and washing (for example, 20 volumes of Tris magnesium / saccharose TM pH 7.4) can be repeated.
[001154] [001154] In the next step, the fusosome fraction is separated by fluctuation in a discontinuous sucrose density gradient. A small excess of remaining supernatant is left with the washed granule, which now includes fusosomes, nuclei and whole cells that have been completely broken. An additional 60% w / w sucrose in TM, pH 8.6, is added to the suspension to give a 45% sucrose reading on a refractometer. After this step, all solutions are TM pH 8.6. 15 ml of suspension are placed in cellulose nitrate tubes SW-25.2 and a discontinuous gradient is formed over the suspension by adding layers of 15 ml, respectively 40% and 35% w / w sucrose and then adding 5 ml of TM-sucrose (0.25 M). The samples are then centrifuged at 20,000 rom for 10 min, 4ºC. The core granule forms a granule, the whole cells completely broken are collected at the interface 40% to 45%, and the fusosomes are collected at the interface 35% to 40%. Multi-tube fusosomes are collected and combined.
[001155] [001155] See, for example, the international patent publication WO 2011024172A 2. EXAMPLE 12: GENERATION OF FUSOSOMES BY EXTRUSION
[001156] [001156] This example describes the manufacture of fusosomes by extrusion through a membrane.
[001157] [001157] Briefly, hematopoietic stem cells that express fusogens are in suspension at 37ºC at a density of 1 x 10º cells / ml in serum-free medium containing a protease inhibitor cocktail (Set V, Calbiochem 539137- 1ML) . The cells are aspirated with a luer lock syringe and passed once through a disposable 5 mm syringe filter into a clean tube. If the membrane fails and becomes clogged, it is removed and a new filter is attached. After the entire cell suspension has passed through the filter, 5 ml of serum-free medium is passed through all filters used in the process to wash any remaining material through the filter (or filters). The solution is then combined with the fusosomes extruded into the filtrate.
[001158] [001158] Fusosomes can be further reduced in size by continuous extrusion, following the same method, with increasingly smaller filter pore sizes, ranging from 5 mm to 0.2 mm. When the final extrusion is completed, the suspensions are granulated by centrifugation (the required time and speed vary in size) and resuspended in the medium.
[001159] [001159] In addition, this process can be complemented with the use of an actin cytoskeleton inhibitor, in order to reduce the influence of the existing cytoskeletal structure in the extrusion. In short, a suspension of 1 x 10º cells / ml! it is incubated in serum-free medium with 500 nM Latrunculin B (ab144291, Abcam, Cambridge, MA) and incubated for 30 minutes at 37ºC in the presence of 5% CO ». After incubation, the protease inhibitor cocktail is added and the cells are aspirated into a luer lock syringe, with the extrusion performed as previously described.
[001160] [001160] Fusosomes are granulated and washed once in PBS to remove the cytoskeletal inhibitor before being resuspended in the medium. EXAMPLE 13: GENERATION OF FUSOSOMES THROUGH CHEMICAL TREATMENT WITH PROTEIN
[001161] [001161] This example describes the chemical-mediated delivery of fusogens to generate fusosomes. Approximately 5 x 10 th cells or vesicles are used for chemical-mediated delivery of spindles. The cells or vesicles are suspended in 50 µl of Opti- MEM medium. To configure a master mix, 24 μg of purified protein fusogens are mixed with 25 μl of Opti-MEM medium, followed by the addition of 25 μl of Opti-MEM containing 2 μl of 3000 lipid transfection reagent. The cells or vesicles and solutions of fusogen are mixed by gently shaking the plate and incubating at 37ºC for 6 hours, so that the fusogen is incorporated into the
[001162] [001162] See also Liang et al., Fast and high-efficiency mammalian cell engineering via protein transfection Cas9, Journal of Biotechnology 208: 44 to 53, 2015. EXAMPLE 14: FUSOSOMES GENERATION THROUGH TREATMENT WITH LIPOSOMES CONTAINING FUSOGEN
[001163] [001163] This example describes the liposome-mediated delivery of fusogens to a source cell to generate fusosomes. Approximately 5 x 10 th cells or vesicles are used for liposome-mediated delivery of fusogens. The cells or vesicles are suspended in 50 µl of Opti-MEM medium. The fusogen protein is purified from cells in the presence of n-octyl b-D-glycopyranoside. n-octyl b-D-glycopyranoside is a mild detergent used to soluble integral membrane proteins. The fusogenic protein is then reconstituted into large unilamellar vesicles (LUVs) (400nm diameter) by mixing the suspended protein n-octyl bD-glycopyranoside with LUVs pre-saturated with n-octyl bD-glycopyranoside, followed by removal of n-octyl bD- glycopyranoside, as described in Top et al., EMBO 24: 2980 to 2988, 2005. To configure a main mixture, a mass of liposomes containing 24 µg of total fusogenic protein is mixed with 50 µl of Opti medium -MEM. The solutions of | i-pods and cells of origin or vesicles are then combined, and the whole solution is mixed by gently shaking the plate and incubating at 37ºC for 6 hours under conditions that allow the fusion of the liposomes containing fusogen and the cells of origin or vesicle, so that the fusogenic protein is incorporated in the originating cell or in the vesicle membrane. The fusosomes are then washed with PBS, resuspended in PBS and kept on ice.
[001164] [001164] See also Liang et al., Fast and high efficiency mammalian cell engineering via protein transfection Cas9, Journal of Biotechnology 208: 44 to 53, 2015. EXAMPLE 15: ISOLATION OF FUSOGENIC MICROVESICLES- CAS RELEASED FREELY FROM CELLS
[001165] [001165] This example describes the isolation of fusosomes by centrifugation. This is one of the methods by which fusosomes can be isolated.
[001166] [001166] Fusosomes are isolated from cells that express fuses by differential centrifugation. The culture medium (DMEM + 10% fetal bovine serum) is first cleared of small particles by ultracentrifugation at> 100,000 x g for 1 h. Clarified culture media are then used to grow embryonic mouse fibroblasts that express fusogens. The cells are separated from the culture media by centrifugation at 200 x g for 10 minutes. The supernatants are collected and centrifuged sequentially twice at 500 x g for 10 minutes, once at 2,000 x g for 15 minutes, once at 10,000 x g for 30 minutes and once at 70,000 x g for 60 minutes. Freely released fusosomes are granulated during the final centrifugation step, resuspended in PBS and repelled at
[001167] [001167] See also Wubbolts R et al. Proteomic and Biochemical Analyzes of Human B Cell-derived Exosomes: Potential Implications for their Function and Multivesicular Body Formation. J. Biol. Chem. 278: 10963 to 10972 2003. EXAMPLE 16: PHYSICAL ENUCLEATION OF FUSOSOMES
[001168] [001168] This example describes the enucleation of fusosomes by cytoskeletal inactivation and centrifugation. This is one of the methods by which fusosomes can be modified.
[001169] [001169] Fusosomes are isolated from primary or immortalized mammalian cell lines that express a fusogen. The cells
[001170] [001170] The staining of the nuclear content with Hoechst 33342, as described in Example 35, followed by the use of flow cytometry and / or imaging, will be performed to confirm the ejection of the nucleus. EXAMPLE 17: MODIFICATION OF FUSOSOMES BY IRRADIA- DOG
[001171] [001171] The following example describes the modification of fusosomes with gamma irradiation. Without being limited by theory, gamma irradiation can cause breaks in the DNA and cause cells to undergo apoptosis.
[001172] [001172] First, cells expressing fusogens are cultured in a monolayer in flasks or tissue culture plates below a confluent density (for example, by culturing or plating cells). Then, the medium is removed from the confluent flasks, the cells are rinsed with Ca * And Mg * Free HBSS, and trypsinized to remove the cells from the culture matrix. The cell granule is then resuspended in 10 ml of tissue culture medium without penicillin / streptomycin and transferred to a Petri dish of
[001173] [001173] The following example describes the modification of fusosomes with treatment with mitomycin C. Without being linked to any particular theory, treatment with mitomycin C modifies the spindles-inomes by inactivating the cell cycle.
[001174] [001174] First, cells that express fusogens are cultured from a monolayer in flasks or tissue culture plates at a confluent density (for example, by culturing or plating cells). A stock solution of mitomycin C in mg / ml is added to the medium to a final concentration of 10 µg / ml. The plates are then returned to the incubator for 2 to 3 hours. Then, the medium is removed from the confluent flasks, the cells are rinsed with Ca * And Mg * Free HBSS, and trypsinized to remove the cells from the culture matrix. The cells are then washed and resuspended in the buffer or final medium to be used.
[001175] [001175] See, for example, Mouse Embryo Fibroblast (MEF) Feeder Cell Preparation, Current Protocols in Molecular Biology. David A. Conner, 2001. EXAMPLE 19: LACK OF TRANSCRIPTIONAL ACTIVITY IN FU- SOSOMES
[001176] [001176] This Example quantifies the transcriptional activity in fososomes compared to parental cells, for example, parent cells, used to generate fusosomes. In one embodiment, transcriptional activity will be low or absent in fusosomes compared to parental cells, for example, cells of origin.
[001177] [001177] Fusosomes are a chassis for the delivery of the therapeutic agent. Therapeutic agents such as mMIRNA, mRNAs, proteins and / or organelles that can be delivered to cells or local tissue environments with high efficiency can be used to modulate pathways that are not normally active or active at low or high pathological levels in the tissue receiver. In one embodiment, the observation that fusosomes are not capable of transcription or that fososomes have less transcriptional activity than their parent cell will demonstrate that the removal of nuclear material has occurred sufficiently.
[001178] [001178] Fusosomes are prepared by any of the methods described in the previous examples. A sufficient number of fososomes and parental cells used to generate the fusosomes are then plated on a 6-well low-adhesion multi-well plate in DMEM containing 20% fetal bovine serum, 1x Penicillin / Streptomycin and the EU alkaline nucleoside fluorescence-marked for 1 hour at 37ºC and 5% CO ». For negative controls, a sufficient number of fusosomes and parental cells are also plated on multiple well plates in the DMEM containing 20% fetal bovine serum, 1x penicillin / streptomycin, but without alkaline nucleoside EU.
[001179] [001179] After the 1 hour incubation, the samples are processed following the manufacturer's instructions for an imaging kit (Thermo-Fisher Scientific). Cell and fusosome samples, including negative controls, are washed three times with 1xPBS buffer and resuspended in 1xPBS buffer and analyzed by flow cytometry (Becton Dickinson, San Jose, CA, USA) using a 488 argon laser. nm for excitation and the emission of 530 +/- 30 nm. The BD FACSDiva software was used for acquisition and analysis. The dispersion channels
[001180] [001180] In one modality, the transcriptional activity measured by emission of 530 +/- 30nm in the negative controls will be null due to the omission of the EU alkino-nucleoside. In some modalities, ptosis will have less than about 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1% or less transcriptional activity than parental cells.
[001181] [001181] See also Proc Natl Acad Sci USA, 2008, October 14; 105 (41): 15779 to 15784. doi: 10.1073 / pnas.0808480105. Epub 2008 October 7. EXAMPLE 20: LACK OF DNA REPLICATION OR ACTIVITY OF REPLICATION
[001182] [001182] This example quantifies DNA replication in fusosomes. In one embodiment, fusosomes replicate DNA at a low rate compared to cells.
[001183] [001183] Fusosomes are prepared by any of the methods described in the previous examples. The DNA replication activity of the fusosome and the parental cell is assessed by the incorporation of a fluorescence labeled nucleotide (ThermoFisher Scientific 4 010632). Fusosomes and an equivalent number of cells are incubated with EdU at a final concentration of 10 µM for 2 hours, after the preparation of a stock solution of EdU with dimethylsulfoxide. The samples are then fixed for 15 min using 3.7% PFA, washed with 1xPBS buffer, pH 7.4 and permeabilized for 15 min in 0.5% detergent solution in 1xPBS buffer, pH 7.4.
[001184] [001184] After permeabilization, fusosomes and cells suspended in PBS buffer containing 0.5% detergent are washed with 1xPBS buffer, pH 7.4 and incubated for 30 min at 21ºC in cocktails.
[001185] [001185] A negative control for the DNA replication activity of the fusosome and the cell is made with samples treated in the same way as above, but without azide-fluorine 488 in the 1x reaction cocktail.
[001186] [001186] The cell and fusosome samples are then washed and resuspended in 1xPBS buffer and analyzed by flow cytometry. Flow cytometry is performed with a FACS cytometer (Becton Dickinson, San Jose, CA, USA) with laser excitation of 488 nm argon and an emission spectrum of 530 +/- 30 nm is collected. The FACS analysis software is used for acquisition and analysis. The light scattering channels are defined in linear gains and the fluorescence channels on a logarithmic scale, with a minimum of 10,000 cells analyzed in each condition. The relative DNA replication activity is calculated based on the average azide fluoride intensity 488 in each sample. All events are captured in the forward and side scatter channels (alternatively, a gate can be applied to select only the fusosome population). The normalized value of the fluorescence intensity for the fusosomes is determined by subtracting the average value of the fluorescence intensity of the fossosome from the average value of the fluorescence intensity of the respective negative control sample. Then, the normalized relative DNA replication activity for the fusosome samples is normalized for the respective nucleated cell samples, in order to generate quantitative measurements for DNA replication activity.
[001187] [001187] In one embodiment, fusosomes have less DNA replication activity than parental cells.
[001188] [001188] See also salica, 2415 to 2420, doi: 10.1073 / pnas.
[001189] [001189] This example describes the electroporation of fusosomes with nucleic acid charge.
[001190] [001190] Fusosomes are prepared by any of the methods described in a previous example. Approximately 10º spindlesome and 1 µg of nucleic acids, for example, RNA, are mixed in electroporation buffer (1.15 mM potassium phosphate, pH 7.2, mM potassium chloride, 60% iodixanol p / v in water). Fososomes are electroporated using a single 4 mm cuvette using an electroporation system (BioRad, 165-2081). The spindles and nucleic acids are electroporated at 400 V, 125 puF and ohms, and the cuvette is immediately transferred to the ice. After electroporation, the fusosomes are washed with PBS, resuspended in PBS and kept on ice.
[001191] [001191] See, for example, Kamerkar et al., Exosomes facilitate the therapeutic targeting of oncogenic KRAS in pancreatic cancer, Nature, 2017 EXAMPLE 22: ELECTROPORATION TO MODIFY SPINDLES- SUM WITH PROTEIN LOAD
[001192] [001192] This example describes the electroporation of fusosomes with protein charge.
[001193] [001193] Fusosomes are prepared by any of the methods described in a previous example. Approximately 5 x 10º fumesosomes are used for electroporation using a transfection electroporation system (Thermo Fisher Scientific). To configure a master mix, 24 µg of purified protein charge is added to the resuspension buffer (provided in the kit). The mixture is incubated at room temperature for 10 min. Meanwhile, the fososomes are transferred to a sterile test tube and centrifuged
[001194] [001194] See, for example, Liang et al., Rapid and highly efficiency mamrmmalian cell engineering via Cas9 protein transfection, Journal of Biotechnology 208: 44 to 53, 2015. EXAMPLE 23: CHEMICAL TREATMENT OF FUSOSOMES FOR MODIFY WITH NUCLEIC ACID LOAD
[001195] [001195] This example describes the loading of nucleic acid charge in a fusosome by means of chemical treatments.
[001196] [001196] Fusosomes are prepared by any of the methods described in the previous examples. Approximately 10º spindles-sums are granulated by centrifugation at 10,000 g for 5 min at 4ºC. The granulated fusosomes are then resuspended in TE buffer (10 mM Tris-HCI (pH 8.0), 0.1 mM EDTA) with 20 µg of DNA. The fusosome solution: DNA is treated with a mild detergent to increase DNA permeability across the fusosome membrane (Reagent B, Cosmo Bio Co., LTD, Catalog No. ISK-GN-001-EX). The solution is centrifuged again and the granule is resuspended in buffer with a positively charged peptide, such as protamine sulfate, to increase the affinity between DNA-loaded fusosomes and the target cells (Reagent C, Cosmo Bio Co ., LTD, catalog number ISK-GN-001-EX). After loading the DNA, the charged fusosomes are kept on ice before use.
[001197] [001197] See also Kaneda, Y,., Et al., New vector innovation for drug delivery: development of fusigenic non-viral particles. Curr. Drug
[001198] [001198] This example describes the loading of protein charge in a fusosome through chemical treatments.
[001199] [001199] Fusosomes are prepared by any of the methods described in the previous examples. Approximately 10º spindles-sums are granulated by centrifugation at 10,000 g for 5 min at 4ºC. Granulated fusosomes are then resuspended in buffer with positively charged peptides, such as protamine sulfate, to increase the affinity between fusosomes and charge proteins (Reagent A, Cosmo Bio Co., LTD, Catalog No. ISK-GN-001- EX). Then 10 µg of loading protein is added to the fusosome solution, followed by the addition of a mild detergent to increase the permeability of the protein across the fusosome membrane (Reagent B, Cosmo Bio Co., LTD, Catalog No. ISK -GN-001-EX). The solution is centrifuged again and the granule is resuspended in buffer with the positively charged peptide, such as protamine sulfate, to increase the affinity between protein-loaded fusosomes and the target cells (Reagent C, Cosmo Bio Co ., LTD, Catalog No. ISK-GN-001-EX). After loading the protein, the loaded fusosomes are kept on ice before use.
[001200] [001200] See also Yasouka, E. et al., Needleless intranasal administration of HVJ-E containing allergen attenuates experimental allergic rhinitis. J. Mol. Med., 2007 EXAMPLE 25: TRANSFECTION OF FUSOSOMES FOR MODIFICATION CAR WITH NUCLEIC ACID LOAD
[001201] [001201] This example describes the transfection of a charged nucleic acid charge (for example, a DNA or mRNA) in a fusosome. Fusosomes are prepared by any of the methods described
[001202] [001202] 5 x 1086 fusosomes are maintained in Opti-Mem. 0.5 µg of nucleic acid is mixed with 25 µl of Opti-MEM medium, followed by the addition of 25 µl of Opti-MEM containing 2 µl of lipid transfection reagent 2000. The mixture of nucleic acids, Opti-MEM and lipid transfection reagent is kept at room temperature for 15 minutes and then added to the fusosomes. The entire solution is mixed by gently shaking the plate and incubating at 37ºC for 6 hours. The fusosomes are then washed with PBS, resuspended in PBS and kept on ice.
[001203] [001203] See also Liang et al., Fast and high-efficiency mammalian cell engineering via protein transfection Cas9, Journal of Biotechnology 208: 44 to 53, 2015. EXAMPLE 26: TRANSFECTION OF FUSOSOMES FOR MODIFICATION CAR WITH PROTEIN LOAD
[001204] [001204] This example describes the transfection of protein charge in a fusosome.
[001205] [001205] Fusosomes are prepared by any of the methods described in the previous examples. 5 x 106 fusosomes are maintained in Opti-Mem. 0.5 μg of purified protein is mixed with μl of Opti-MEM medium, followed by the addition of 25 μl of Opti-MEM containing 2 μl of lipid transfection reagent 3000. The protein mixture, Opti-MEM and lipid transfection reagent it is kept at room temperature for 15 minutes and then added to the fossa. The entire solution is mixed by gently shaking the plate and incubating at 37ºC for 6 hours. The fusosomes are then washed with PBS, resuspended in PBS and kept on ice.
[001206] [001206] See also Liang et al., Fast and high-efficiency mammalian cell engineering via Cas9 protein transfection, Journal of Biotechnology 208: 44 to 53, 2015.
[001207] [001207] This example describes the composition of fusosomes. In one embodiment, a fusosome composition will comprise a lipid bilayer structure, with a lumen in the center.
[001208] [001208] Without wishing to be bound by theory, the lipid bilayer structure of a fusosome promotes fusion with a target cell and allows fusosomes to carry different therapies.
[001209] [001209] Fusosomes are freshly prepared using the methods described in the previous examples. The positive control is the native cell line (HEK293) and the negative control is cold DPBS and HEK293 cell preparation with membrane rupture, which was passed through 36 gauge needles 50 times.
[001210] [001210] The samples are centrifuged in the Eppendorf tube and the supernatant is carefully removed. Then, a preheated fixative solution (2.5% glutaraldehyde in 0.05 M cacodylate buffer with 0.1 M NaCl, pH 7.5; keep at 37 ° C for 30 min before use) is added to the sample granule and kept at room temperature for 20 minutes. The samples are washed twice with PBS after fixation. Osmium tetroxide solution is added to the sample granule and incubated for 30 minutes. After washing once with PBS, 30%, 50%, 70% and 90% hexylene glycol are added and washed with agitation, 15 minutes each. Then, 100% hexylene glycol is added with stirring, 3 times, 10 minutes each.
[001211] [001211] The resin is combined with hexylene glycol in the ratio of 1: 2 and then added to the samples and incubated at room temperature for 2 hours. After incubation, the solution is replaced with 100% resin and incubated for 4 to 6 hours. This step is repeated once more with 100% fresh resin. It is then replaced with 100% fresh resin, the level is adjusted to - 1 to 2 mm deep
[001212] [001212] In one embodiment, fusosomes will show a lipid bilayer structure similar to the positive control (HEK293 cells), and no obvious structure is seen in the DPBS control. In one embodiment, no luminal structure will be observed in the interrupted cell preparation. EXAMPLE 28: DETECTION OF FUSOGEN EXPRESSION
[001213] [001213] This example quantifies the expression of fusogen in fososomes.
[001214] [001214] Transposase vectors (System Biosciences, Inc.) that include the open reading frame of the Puromycin resistance gene along with an open reading frame of a cloned fragment (eg, stomatitis virus glycoprotein vesicular [VSV-G], Oxford Genetics ft OG592) are electroporated in 293Ts using an electroporator (Amaxa) and a nuclear transfection kit specific for the 293T cell line (Lonza).
[001215] [001215] After selection with 1 ug / ul of puromycin for 3-5 days in DMEM containing 20% fetal bovine serum and 1x penicillin / strepto-mycine, fusosomes are prepared from the cell line that stably expresses or control cells by any of the methods described in previous Examples.
[001216] [001216] Fusosomes are then washed with 1xPBS, cold lysis buffer (150 mM NaCl, 0.1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCIl, pH 8.0 and protease inhibitor Cocktail 11l (Abcam, ab201117)), sonicated 3 times, 10-15 seconds each time and centrifuged at 16,000 xg for 20 min. A werner blot is conducted on the supernatant fraction recovered with a VSV-G specific probe to determine the specific non-membrane concentration of VSV-G of the fusosomes prepared from stably transfected cells or control cells and compared with the VSV-G protein standard.
[001217] [001217] In one embodiment, fusosomes from stably transfected cells will have more VSV-G than fusosomes generated from cells that have not been stably transfected. EXAMPLE 29: QUANTIFICATION OF FUSOGEN
[001218] [001218] This example describes the quantification of the absolute number of fusogens per fusosome.
[001219] [001219] A fusosome composition is produced by any of the methods described in the previous Examples, except that the fososome is designed as described in a previous Example to express a GFP-labeled fusogen (VSV-G). In addition, a negative control fusosome is designed with no fusogen (VSV-G) or GFP present.
[001220] [001220] Fusosomes with the GFP-labeled fusogen and the negative control (or controls) are then analyzed for the absolute number of fusogens as follows. The commercially acquired recombinant GFP is serially diluted to generate a protein concentration calibration curve. The GFP fluorescence of the calibration curve and a sample of fusosomes of known quantity are then measured on a fluorimeter using a GFP light cube (excitation filter 469/35 and an emission filter 525/39) to calculate the average molar concentration of GFP molecules in the fusosome preparation. The molar concentration is then converted to the number of GFP molecules and divided by the number of fusosomes per sample to achieve an average number of GFP-labeled fusogen molecules per fusosome and, therefore, provides a relative estimate of the number of fusogens per fusosome.
[001221] [001221] In one embodiment, GFP fluorescence will be greater in GFP-labeled fusosomes compared to negative controls, where no fusogen or GFP is present. In one embodiment, GFP fluorescence is relative to the number of fusogen molecules present.
[001222] [001222] Alternatively, individual fusosomes are isolated using a single cell preparation system (Fluidigm) according to the manufacturer's instructions, and gRT-PCR is performed using a set of commercially available probes (Tagman) and main mix designed to quantify D fusogen or GFP cDNA levels based on Ci value levels. An RNA pattern of the same sequence as the cloned fragment of the fusogen or GFP gene is generated by synthesis (Amsbio) and then added to the experimental qRT-PCR reaction of the single cell preparation system in serial dilutions to establish a standard C: curve; versus concentration of fusogen or GFP RNA.
[001223] [001223] The C: value of fusosomes is compared with the standard curve to determine the amount of fusogen or GFP RNA per fusosome.
[001224] [001224] In one embodiment, the fusogen and RF GFP will be higher in fusosomes designed to express fusogens compared to negative controls, where no fusogen or GFP is present.
[001225] [001225] Fusogens can also be quantified in the lipid bilayer by analyzing the structure of the lipid bilayer as previously described and quantifying the fusogens in the lipid bilayer by LC-MS, as described in other examples here.
[001226] [001226] This example describes the measurement of the average size of the fusosomes.
[001227] [001227] Fusosomes are prepared by any of the methods described in the previous examples. Fusosomes measured to determine average size using commercially available systems (iZON Science). The system is used with the software according to the manufacturer's instructions and a nanopore designed to analyze particles within the size range from 40 nm to 10 µm. Fososomes and parental cells are resuspended in phosphate buffered saline (PBS) to a final concentration range of 0.01 to 0.1 µg protein / ml. Other instrument settings are adjusted as indicated in the following table: TABLE 6: FUEL MEASUREMENT PARAMETERS AND SETTINGS
[001228] [001228] All fusosomes are analyzed within 2 hours after isolation. In one embodiment, fusosomes will have a size within about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 90% or greater than parental cells. EXAMPLE 31: MEASUREMENT OF AVERAGE SIZE DISTRIBUTION FUSOSOMES
[001229] [001229] This example describes the measurement of the size distribution of the fusosomes.
[001230] [001230] Fusosomes are generated by any of the methods described in the previous Examples and are tested to determine the average particle size using a commercially available system, as described in a previous Example. In one embodiment, size thresholds for 10%, 50% and 90% of fusosomes centered around the median are compared to parental cells to assess the fusosome size distribution.
[001231] [001231] In one embodiment, fusosomes will have less than about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the variability in the size of the parental cell distribution within 10%, 50% or 90% of the sample. EXAMPLE 32: AVERAGE VOLUME OF FUSOSOMES
[001232] [001232] This example describes the measurement of the average volume of fososomes. Without wishing to be limited by theory, varying the size (for example, volume) of the fusosomes can make them versatile for different loads, therapeutic design or application.
[001233] [001233] Fusosomes are prepared as described in the previous examples. The positive control is HEK293 cells or polystyrene beads with a known size. The negative control is HEK293 cells that are passed through a 36 gauge needle approximately 50 times.
[001234] [001234] Analysis with a transmission electron microscope, as described in a previous example, is used to determine the size of the fusosomes. The diameter of the fusosome is measured and the volume is calculated.
[001235] [001235] In one embodiment, fusosomes will have an average size of approximately 50 nm or more in diameter. EXAMPLE 33: AVERAGE FUSOSOMES DENSITY
[001236] [001236] Fusosome density is measured using a continuous sucrose gradient centrifugation assay, as described in Théry et al., Curr Protoc Cell Biol. April 2006; Chapter 3: Units 3.22. Fusussomas are obtained as described in the previous examples.
[001237] [001237] First, a sucrose gradient is prepared. A 2 M and 0.25 sucrose solution is generated by mixing 4 ml of HEPES stock / sucrose and 1 ml of HEPES stock or 0.5 ml of HEPES stock / sucrose and 4.5 ml of HEPES stock solution, respectively. These two fractions are loaded onto the gradient with all blinds closed, the 2 M sucrose solution in the proximal compartment with a magnetic stir bar and the 0.25 M sucrose solution in the distal compartment. The gradient is placed on a magnetic stirring plate, the obturator between the proximal and distal compartments is opened and the magnetic stirring plate is switched on. The HEPES stock solution is made as follows: 2.4 g of N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; 20 mMfinal), 300 H20, adjust the pH to 7.4 with 10 N NaOH and finally adjust the volume to 500 ml with H20. The HEPES / sucrose stock solution is made as follows: 2.4 g of hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; final mM), 428 g of protease-free sucrose (ICN; 2.5 M final) , 150 ml of H2O, adjust the pH to 7.4 with 10 N NaOH and finally adjust the volume to 500 ml with H20.
[001238] [001238] The fusosomes are resuspended in 2 ml of HEPES / sucrose stock solution and are poured into the bottom of a SW 41 centrifuge tube. The outer tube is placed in the SW 41 tube, just above the 2 ml of fusosomes. The external plug is opened and a continuous sucrose gradient of 2 M (lower) to 0.25 M (upper) is poured slowly over the top of the fusosomes. The SW 41 tube is lowered as the gradient is poured, so that the tube is always slightly above the top of the liquid.
[001239] [001239] All tubes with gradients are balanced with each other or with other tubes with the same weight as sucrose solutions. The gradients are centrifuged overnight (214 h) at 210,000 x g, 4ºC, in the SW 41 swing bucket rotor with the brake set at low level.
[001240] [001240] With a micropipette, eleven fractions of 1 ml, from top to bottom, are collected and placed in a 3 ml tube for the TLA-100.3 rotor. The samples are taken and, in separate wells of a 96-well titration plate, 50 µl of each fraction is used to measure the refractive index. The plate is covered with adhesive paper to prevent evaporation and stored for no more than 1 hour at room temperature. A refractometer is used to measure the refractive index (hence the concentration of sucrose and density) from 10 to 20 μl of each fraction of the material saved in the 96-well titration plate.
[001241] [001241] A table to convert the refractive index to g / ml is available in the ultracentrifugation catalog available for download on the Beckman website.
[001242] [001242] Each fraction is then prepared for the analysis of protein content. Two milliliters of 20 mM HEPES, pH 7.4, are added to each 1 ml gradient fraction and mixed by pipetting up and down two to three times. One side of each tube is marked with a permanent marker and the tubes are placed face up on a TLA-100.3 rotor.
[001243] [001243] The 3 ml tubes with diluted fractions are centrifuged for 1 hour at 110,000 x g, 4ºC. The TLA-100.3 rotor has six tubes, so that two centrifugations for each gradient are performed with the other tubes kept at 4ºC until they can be centrifuged.
[001244] [001244] The supernatant is aspirated from each of the 3 ml tubes, leaving a drop on top of the granule. The granule is probably not visible, but its location can be inferred from the mark on the tube. The invisible granule is resuspended and transferred to microcentrifuge tubes. Half of each resuspended fraction is used for protein content analysis by the bicinconinic acid assay, described in another Example. This provides a distribution between the various gradient fractions of the fusosome preparation. This distribution is used to determine the average density of the fusosomes. The fraction of the second half volume is stored at -80ºC and used for other purposes (for example, functional analysis or additional purification by immunoisolation), since protein analysis reveals the distribution of the fusosome between the fractions.
[001245] [001245] In one embodiment, using this assay, the average density of the fusosomes will be 1.25 g / ml +/- 0.05 standard deviation. In one embodiment, the average density of the fusosomes will be in the range of 1 to 1.1, 1.05 to 1.15, 1.1 to 1.2, 1.15 to 1.25, 1.2 to 1.3 or 1.25 to 1.35. In one embodiment, the average density of the fusosomes will be less than 1 or more than 1.35. EXAMPLE 34: MEASUREMENT OF ORGANELES CONTENT IN SPINDLES SUMMITS
[001246] [001246] This example describes the detection of spindle cell organelles.
[001247] [001247] Fusosomes were prepared as described herein. For the detection of endoplasmic reticulum (ER) and mitochondria, fusosome cells or C2C12 were stained with 1 uM ER staining (E34251, Thermo Fisher, Waltham, MA) and 1 uM mitochondria staining (M22426, Thermo Fisher Waltham, MA). For the detection of lysosomes, fusosomes or cells were stained with 50 nM | isosome staining (L7526, Thermo Fisher, Waltham, MA).
[001248] [001248] The spotted fusosomes were run in a flow cytometer (Thermo Fisher, Waltham, MA) and the fluorescence intensity was measured for each dye, according to the table below. Validation for the presence of organelles was made by comparing the fluorescence intensity of spotted fusosomes with fusosomes.
[001249] [001249] Fusosomes stained positive for endoplasmic reticulum (Figure 1), mitochondria (Figure 2) and lysosomes (Figure 3) 5 hours after enucleation. TABLE 7: FUSOSOMA STAINS Attune laser wave (nm) EXAMPLE 35: MEASUREMENT OF NUCLEAR CONTENT IN FUSOSOMES
[001250] [001250] This example describes a method of measuring the nuclear content in a fusosome. To validate that the fusosomes do not contain nuclei, the fusosomes are stained with 1 µg-: ml "* of Ho-echst 33342 and 1 µM CalceinAM (C3100MP, Thermo Fisher, Waltham, MA) and the spotted fusosomes are run on a cytometer. Attune NXT flow (Thermo Fisher, Waltham, MA) to determine the fluorescence intensity of each dye according to the table below. In one embodiment, the validation for the presence of cytosol (CalceinAM) and the absence of a nucleus (Hoechst 33342 ) will be made by comparing the mean fluorescence intensity of spotted fusosomes with unblotted fusosomes and stained cells TABLE 8: FLOW CYTOMETER CONFIGURATIONS laser wave (nm) EXAMPLE 36: MEASUREMENT OF NUCLEAR ENVELOPE CONTENT
[001251] [001251] This example describes a measurement of the content of the
[001252] [001252] In one embodiment, a purified fusosome composition comprises a mammalian cell, such as HEK-293Ts (293 [HEK-293] (ATCCO CRL-15737TY), which has been enucleated as described herein. the quantification of different nuclear membrane proteins as a proxy to measure the amount of intact nuclear membrane that remains after the generation of the fusosome.
[001253] [001253] In this example, 10x10º HEK-293Ts and the equivalent amount of fusosomes prepared from 10x10º HEK-293Ts are fixed for 15 minutes using 3.7% PFA, washed with 1xPBS buffer, pH 7.4 and permeabilized simultaneously and then blocked for 15 minutes using 1xPBS Buffer containing 1% bovine serum albumin and 0.5% Triton & X-100, pH 7.4. After permeabilization, fusosomes and cells are incubated for 12 hours at 4 ºC with different primary antibodies, for example (anti-RanGAP1 antibody [EPR3295] (Abcam - ab92360), anti-NUP98 antibody [EPR6678] - marker of nuclear pores (Abcam - ab124980), anti-nuclear pore complex protein antibody [Mab414] - (Ab-cam-ab24609), anti-importin antibody 7 (Abcam - ab213670), in the concentrations suggested by the manufacturer, diluted in 1xPBS buffer containing 1% bovine serum albumin and 0.5% Triton & X -100, pH 7.4.The fusosomes and cells are washed with 1xPBS buffer, pH 7.4 and incubated for 2 hours at 21 ºC with an appropriate fluorescent secondary antibody that detects the primary antibody specified above at the concentrations suggested by the manufacturer, diluted in 1xPBS buffer containing 1% bovine serum albumin and 0.5% detergent, pH 7.4. Fusosomes and cells are then washed with 1xPBS buffer, resuspended in 300 µl of 1xPBS buffer, pH 7.4 containing 1 ug / ml of Hoechst 33342, filtered through a tube
[001254] [001254] Negative controls are generated using the same staining procedure, but without the addition of a primary antibody. Flow cytometry is performed on a FACS cytometer (Becton Dickinson, San Jose, CA, USA) with laser excitation of 488 nm argon and an emission spectrum of 530 +/- 30 nm is collected. The FACS acquisition software is used for acquisition and analysis. The light scattering channels are defined in linear gains and the fluorescence channels on a logarithmic scale, with a minimum of 10,000 cells analyzed in each condition. The relative intact content of the nuclear membrane is calculated based on the median fluorescence intensity in each sample. All events are captured in the forward and side scatter channels.
[001255] [001255] The normalized value of the fluorescence intensity for the fusosomes is determined by subtracting from the average value of the fluorescence intensity of the fusosome the average value of the fluorescence intensity of the respective negative control sample. Then, the normalized fluorescence for the samples of fusosomes is normalized for the respective samples of nucleated cells, in order to generate quantitative measurements of the intact content of the nucleus membrane.
[001256] [001256] In one embodiment, enucleated fusosomes will comprise less than 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80% or 90% fluorescence intensity or nuclear envelope content compared to nucleated parental cells. EXAMPLE 37: MEASUREMENT OF CHROMATIN LEVELS
[001257] [001257] This example describes the measurement of chromatin in enucleated spindles.
[001258] [001258] DNA can be condensed into the chromatin to allow it to fit inside the nucleus. In one embodiment, a purified fusosome composition as produced by any of the methods described in this document will comprise low levels of chromatin.
[001259] [001259] Enucleated fusosomes prepared by any of the methods described above and positive control cells (eg, parental cells) are analyzed for chromatin content using an ELISA with antibodies specific for histone H3 protein or histone H4 protein. Histones are the main protein component of chromatin, with H3 and H4 the predominant histone proteins.
[001260] [001260] Histones are extracted from the fusosome preparation and cell preparation using a commercial kit (for example, Histone Abcam Extraction Kit (ab113476)) or other methods known in the art. These rates are stored at -80ºC until use. A serial dilution of the standard is prepared by diluting the purified histone protein (H3 or H4) from 1 to 50 ng / ul in a solution of the assay buffer. The assay buffer can be obtained from a kit provided by a manufacturer (for example, Abcam Histone H4 Total Quantification Kit (ab156909) or Abcam Histon H3 Total Quantification Kit (ab115091)). The assay buffer is added to each well of a 48 or 96 well plate, which is coated with an anti-histone H3 or anti-H4 antibody and the standard sample or control is added to the well to increase the total volume of each well at 50 ul. The plate is then covered and incubated at 37 degrees for 90 to 120 minutes.
[001261] [001261] After incubation, any histone bound to the anti-histone antibody attached to the plate is prepared for detection. The supernatant is aspirated and the plate is washed with 150 µl of wash buffer. The capture buffer, which includes an anti-histone H3 or anti-H4 antibody, is then added to the plate in a volume of 50 µl and to a concentration
[001262] [001262] Then, the plate is aspirated and washed 6 times using washing buffer. The signal reporter molecule activable by the capture antibody is then added to each well. The plate is covered and incubated at room temperature for 30 minutes. The plate is then aspirated and washed 4 times using wash buffer. The reaction is stopped by adding the stop solution. The absorbance of each well on the plate is read at 450 nm, and the concentration of histones in each sample is calculated according to the standard absorbance curve at 450 nm vs. histone concentration in standard samples.
[001263] [001263] In one embodiment, the fusosome samples will comprise less than 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80% or 90% of the histone concentration of nucleated parent cells. EXAMPLE 38: MEASUREMENT OF DNA CONTENT IN SPINDLES BUT
[001264] [001264] This example describes the quantification of the amount of DNA in a fusosome in relation to the nucleated correspondences. In one embodiment, fusosomes will have less DNA than nucleated homologues. Nucleic acid levels are determined by measuring the total DNA or the level of a specific gene for housekeeping. In one embodiment, fusosomes with reduced DNA content or substantially lacking DNA will be unable to replicate, differentiate or transcribe genes, ensuring that their dose and function are not altered when administered to a subject.
[001265] [001265] Fusosomes are prepared by any of the methods described in the previous examples. Preparations with the same mass measured by the fusosome protein and source cells are used to isolate the total DNA (for example, using a kit such as the Qiagen DNeasy * 69504 catalog), followed by determining the DNA concentration using standard spectroscopic methods to evaluate the absorbance of light by DNA (for example, with Thermo Scientific NanoDrop).
[001266] [001266] In one embodiment, the DNA concentration in the enucleated spindles will be less than about 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1% or less than in parental cells.
[001267] [001267] Alternatively, the concentration of a specific home maintenance gene, such as GAPDH, can be compared between nucleated cells and fusosomes with semi-quantitative real-time PCR (RT-PCR). Total DNA is isolated from parental cells and the concentration of fusosome and DNA is measured as described here. RT-PCR is performed with a PCR kit (Applied Biosystems, catalog number 4309155) using the following reaction model:
[001268] [001268] SYBR Mix Verde Master: 10 ul
[001269] [001269] Initiator forward of 0.45 UM: 1u!
[001270] [001270] 0.45 UM Reverse Initiator: 14
[001271] [001271] DNA preset: 10 ng
[001272] [001272] Grade PCR Water: Variable
[001273] [001273] The forward and reverse primers are purchased from Integrated DNA Technologies. The table below details the pairs of primers and their associated sequences: TABLE 9: STARTING SEQUENCES (53) back (53) (GAPDH) CTGATGATCTTGAGG A real-time PCR system (Applied Biosystems) is used to perform amplification and detection with the following protocol:
[001274] [001274] A standard curve of concentration C; versus DNA is prepared with serial dilutions of the GAPDH DNA and used to standardize the nuclear Ct value of the fusosome PCR results for a specific amount (ng) of DNA.
[001275] [001275] In one embodiment, the concentration of GAPDH DNA in enucleated fusosomes will be less than about 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1% or less than in parent cells. EXAMPLE 39: MEASUREMENT OF MIRN CONTENT IN FUSOSOMES
[001276] [001276] This example describes the quantification of microRNAs (MIRNAs) in fusosomes. In one embodiment, a fusosome comprises miRNAs.
[001277] [001277] MIRNAs are regulatory elements that, among other activities, control the rate at which messenger RNAs (mMRNAs) are translated into proteins. In one embodiment, fusosomes that carry miRNA can be used to deliver miRNA to target locations.
[001278] [001278] Fusosomes are prepared by any of the methods described in the previous examples. Fusosomes or parental cell RNA is prepared as described above. At least one miRNA gene is selected from the miRNA registry at Sanger Center at www.sanger.ac.uk/Software/Rfam/mirna/index.shtml. miR-NA is prepared as described in Chen et al, Nucleic Acids Research, 33 (20), 2005. All TaqMan miRNA assays are available from Thermo Fisher (A25576, Waltham, MA).
[001279] [001279] qPCR is performed according to the specifications of the
[001280] [001280] In one embodiment, the miRNA content of the fusosomes will be at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 90% or more than their parental cells. EXAMPLE 40: QUANTIFICATION OF EXPRESSION OF AN ANN DOGEN OR SYNTHETIC RNA IN FUSOSOMES
[001281] [001281] This example describes the quantification of levels of endogenous RNA with altered expression or a synthetic RNA that is expressed in a fusosome.
[001282] [001282] The fusosome or parental cell is designed to alter the expression of an endogenous or synthetic RNA that mediates a cellular function in fusosomes.
[001283] [001283] Transposase vectors (System Biosciences, Inc.) include the open reading frame of the Puromycin resistance gene along with an open reading frame of a cloned fragment of a protein agent. The vectors are electroporated in 293Ts using an electroporator (Amaxa) and a 293T cell line specific nuclear transfection kit (Lonza).
[001284] [001284] After selection with puromycin for 3 to 5 days in DMEM containing 20% fetal bovine serum and 1x penicillin / streptomycin, fusosomes are prepared from the stable expression cell line by any of the methods described in the examples previous ones.
[001285] [001285] Individual fusosomes are isolated and the fusosome protein or RNA agent is quantified as described in a previous Example.
[001286] [001286] In one embodiment, the fusosomes will have at least 1,2, 3, 4, 5, 10, 20, 50, 100, 500, 10%, 5.0 x 103, 10, 5.0 x 10, 105 , 5.0 x 105, 106, 5.0 x 10º or more of the RNA per fusosome.
[001287] [001287] This example describes the quantification of the lipid composition of fusosomes. In one embodiment, the lipid composition of the fusosomes is similar to the cells from which they are derived. The lipid composition affects important biophysical parameters of fusosomes and cells, such as size, electrostatic interactions and colloidal behavior.
[001288] [001288] Lipid measurements are based on mass spectrometry. Fusosomes are prepared by any of the methods described in the previous examples.
[001289] [001289] Lipid analysis based on mass spectrometry is performed in a lipid analysis service (Dresden, Germany), as described (Sampaio, et al., Proc Natl Acad Sci, 2011, February 1; 108 (5 ): 1903 to 1907). Lipids are extracted using a two-stage chloroform / methanol procedure (Ejsing et al., Proc Natl Acad Sci, 2009, March 17; 106 (7): 2136 to 2141). The samples are mixed with a standard internal lipid mixture of: cardiolipin 16: 1/15: 0/15: 0/15: 0 (CL), ceramide 18: 1; 2/17: 0 (Cer), diacylglycerol 17: 0 / 17: 0 (DAG), hexosilceramide 18: 1; 2/12: 0 (HexCer), lysophosphatidate 17: 0 (LPA), smooth phosphatidylcholine 12: 0 (LPC), smooth phosphatidylethanolamine 17: 1 (LPE), smooth phosphatidylglycerol 17: 1 (LPG), smooth phosphatidylinositol 17: 1 (LPI), smooth phosphatidyl serine 17: 1 (LPS), phosphatidate 17: 0/17: 0 (PA), phosphatidylcholine 17: 0/17 : 0 (PC), phosphatidylethanolamine 17: 0/17: 0 (PE), phosphatidylglycerol 17: 0/17: 0 (PG), phosphatidylinositol 16: 0/16: 0 (PI), phosphatidylserine 17: 0 / 17: 0 (PS), cholesterol ester 20: 0 (CE), sphingomyelin 18: 1; 2/12: 0; 0 (SM) and triacylglycer | 17: 0/17: 0/17: 0 (TAG).
[001290] [001290] After extraction, the organic phase is transferred to an infusion plate and dried in a vacuum speed concentrator. The dry extract from the first step is resuspended in 7.5 mM ammonium acetate in chloroform / methanol / propanol (1: 2: 4, V: V: V) and the dry extract from the second step is resuspended in ethanol solution at 33% methylamine in chloroform / methanol (0.003: 5: 1; V: V: V). All liquid handling steps are performed using a robotic platform for organic solvent with an anti-droplet control feature (Hamilton Robotics) for pipetting.
[001291] [001291] The samples are analyzed by direct infusion on a mass spectrometer (Thermo Scientific) equipped with an ion source (Advion Biosciences). The samples are analyzed in positive and negative ion modes, with a resolution of Rm / z = 200 = 280000 for MS and Rm / z = 200 = 17500 for experiments in conjunction with MS / MS, in a single acquisition. MS / MS is triggered by an inclusion list that covers corresponding MS mass ranges digitized in 1 Da increments (Surma, et al., Eur J. lipid Sci Technol, 2015, October; 117 (10): 1540 to 1549). MS and MS / MS data are combined to monitor CE, DAG and TAG ions as ammonium adducts; PC, PC O-, as acetate adducts; and CL, PA, PE, PE O-, PG, Pl and PS as deprotonated anions. MS is used only to monitor LPA, LPE, LPE O-, LPI | and LPS as deprotonated anions; Cer, HexCer, SM, LPC and LPC O- as acetate.
[001292] [001292] The data are analyzed with the lipid identification software developed internally, as described in the following references (Herzog, et al., Genome Biol, 2011, January 19; 12 (1): R8; Herzog, et al., PLoS One, 2012, Jan; 7 (1): e29851). Only lipid identifications with a signal-to-noise ratio> 5 and a signal intensity 5 times greater than in the corresponding blank samples are considered for further data analysis.
[001293] [001293] The fusosome lipid composition is compared to the lipid composition of parental cells. In one embodiment, fusosomes and parental cells will have a similar lipid composition if> 50% of the lipids identified in the parental cells are present in the fusosomes, and of those identified lipids, the level in the fusosome will be> 25% of the corresponding lipid level in the rental cell. EXAMPLE 42: MEASUREMENT OF PROTEOMIC COMPOSITION IN FU- SOSOMES
[001294] [001294] This example describes the quantification of the prosthetic composition of fusosomes. In one embodiment, the protein composition of the fusosomes will be similar to the cells from which they are derived.
[001295] [001295] Fusosomes are prepared by any of the methods described in the previous examples. Fusosomes are resuspended in lysis buffer (7M urea, 2M thiourea, 4% (w / v) Chaps in 50 mM Tris, pH 8.0) and incubated for 15 minutes at room temperature with occasional vortex. The mixtures are then lysed by sonication for 5 minutes in an ice bath and centrifuged for minutes at 13,000 RPM. The protein content is determined by a colorimetric assay (Pierce) and the protein in each sample is transferred to a new tube and the volume is equalized with 50 mM Tris pH
[001296] [001296] Proteins are reduced for 15 minutes at 65 Celsius with 10 mM DTT and alkylated with 15 mM iodoacetamide for 30 minutes at room temperature in the dark. The proteins are precipitated with the gradual addition of 6 volumes of cold acetone (-20 Celsius) and incubated overnight at -80 Celsius. The protein granules are washed 3 times with cold methanol (-20 Celsius). The proteins are resuspended in 50 mM Tris, pH 8.3.
[001297] [001297] Then trypsin / lysC is added to the proteins during the first 4 hours of digestion at 37 degrees Celsius with stirring. The samples are diluted with 50 mM Tris pH 8 and 0.1% sodium deoxycholate is added with more trypsin / lisC for overnight digestion at 37 Celsius with stirring. Digestion is stopped and sodium deoxycholate is removed by adding 2% v / v formic acid. The samples are vortexed and cleaned by centrifugation for 1 minute.
[001298] [001298] To have quantitative measurements, a protein standard is also performed on the instrument. Standard peptides (Pierce, equivalent, grade LC-MS, t 88342) are diluted to 4, 8, 20, 40 and 100 fmol / ul and are analyzed by LC-MS / MS. The average AUC (area under the curve) of the top 5 peptides per protein (transition / peptide 3 MS / MS) is calculated for each concentration to generate a standard curve.
[001299] [001299] The acquisition is carried out with a high resolution mass spectrometer (ABSciex, Foster City, CA, USA) equipped with an electrospray interface with a 25 um iD capillary and coupled with ultra high performance liquid chromatography (pUHPLC) (Eksilent, Redwood City, CA, USA). The analysis software is used to control the instrument and for data processing and acquisition. The source voltage is adjusted to 5.2 kV and maintained at 225ºC, the curtain gas is adjusted to 0.186 MPa (27 psi), gas one to 0.083 MPa (12 psi) and gas two to 0.069 MPa (10 psi). The acquisition is carried out in the information dependent acquisition mode (IDA) for the protein database and in the SWATH acquisition mode for the samples. The separation is carried out in a reverse phase column of 0.3 µm, particles of 2.7 µm, 150 mm in length (Advance Materials Technology, Wilmington, DE) that is maintained at 60ºC. The samples are injected by overflow loop in a 5 ul loop. For the 120-minute LC gradient (samples), the mobile phase includes the following:
[001300] [001300] For the absolute quantification of proteins, a standard curve (5 points, R2> 0.99) is generated using the sum of the AUC of the 5 best peptides (3 MS / MS ion per peptide) per protein. To generate a database for the analysis of the samples, the DIAUmpire algorithm is executed on each of the 12 samples and combined with the output MGF files in a database. This database is used with the software (ABSciex) to quantify the proteins in each of the samples, using a maximum of 5 transition / peptide and 5 peptide / protein. A peptide is considered to be adequately measured if the calculated score is greater than 1.5 or has an FDR <1%. The sum of the AUC for each of the properly measured peptides is mapped on the standard curve and is reported as fmol.
[001301] [001301] The resulting protein quantification data are then analyzed to determine the protein levels and proportions of known classes of proteins as follows: enzymes are identified as proteins noted with an Enzyme Commission (EC) number; ER-associated proteins are identified as proteins that had a classification in the ER cell compartment of Gene Ontology (GO; http://www.geneontology.org) and not mitochondria; exosome-associated proteins are identified as proteins that have a classification in the Gene Ontology cell compartment of exosomes and not mitochondria; and mitochondrial proteins are identified as proteins identified as mitochondrials in the MitoCarta database (Calvo et al., NAR 2015I doi:
[001302] [001302] The proteomic composition of the fusosome is compared to the proteomic composition of the parental cell. In one embodiment, a similar proteomic composition between fusosomes and parent cells will be observed when> 50% of the identified proteins are present in the fusosome and, of those identified proteins, the level will be> 25% of the corresponding protein level in the parental cell . EXAMPLE 43: QUANTIFICATION OF A PROTEIN LEVEL EN- DOUBLE OR SYNTHETIC BY FUSOSOME
[001303] [001303] This example describes the quantification of an endogenous or synthetic protein charge in fusosomes. In one embodiment, fusosomes comprise an endogenous or synthetic protein charge.
[001304] [001304] The fusosome or parental cell is designed to alter the expression of an endogenous protein or to express a synthetic charge that mediates a therapeutic or new cellular function.
[001305] [001305] Transposase vectors (System Biosciences, Inc.) that include the open reading frame of the puromycin resistance gene, along with an open reading frame of a cloned fragment of a protein agent, optionally translationally fused to open reading frame of a green fluorescent protein (GFP). The vectors are electroporated in 293Ts using an electroporator (Amaxa) and a specific nuclear transfection kit for the 293T cell line (Lonza).
[001306] [001306] After selection with puromycin for 3-5 days in DMEM containing 20% fetal bovine serum and 1x penicillin / streptomycin, fusosomes are prepared from the stable expression cell line by any of the methods described in the Examples previous ones.
[001307] [001307] The altered expression levels of an endogenous protein
[001308] [001308] Alternatively, the purified GFP is serially diluted in DMEM containing 20% fetal bovine serum and 1x Penicillin / Streptomycin to generate a standard protein concentration curve. The GFP fluorescence of the standard curve and a sample of fusosomes are measured on a fluorimeter (BioTek) using a GFP light cube (excitation filter 469/35 and an emission filter 525/39) to calculate the concentration molar mean of GFP molecules in fusosomes. At molar concentration it is then converted into the number of GFP molecules and divided by the number of fusosomes per sample to obtain an average number of protein agent molecules per fusosome.
[001309] [001309] In one embodiment, fusosomes will have at least 1,2, 3, 4, 5, 10, 20, 50, 100, 500, 10, 5.0 x 10%, 10%, 5.0 x 10% , 105, 5.0 x 10º, 1086, 5.0 x 108, or more molecules of protein agent per fossa. EXAMPLE 44: MEASUREMENT OF PROTEIN MARKERS EXOSSOMICS IN FUSOSOMES
[001310] [001310] This assay describes the quantification of the protein composition of the sample preparation and quantifies the proportion of proteins that are known to be specific exosome markers.
[001311] [001311] Fusosomes are granulated and sent frozen to the proteomic analysis center by standard procedures for handling biological samples.
[001312] [001312] Fusosomes are thawed for protein extraction and analysis. First, they are resuspended in lysis buffer (7M urea, 2M thiourea, 4% (w / v) cracks in 50 mM Tris at pH 8.0) and incubated for 15 minutes at room temperature with a vortex. occasional. The mixtures are then lysed by sonication for 5 minutes in an ice bath and centrifuged for 5 minutes at 13,000 RPM. The total protein content is determined by a colorimetric assay (Pierce) and 100 µg of protein from each sample is transferred to a new tube and the volume is adjusted with 50 mM Tris at pH
[001313] [001313] Proteins are reduced for 15 minutes at 65 ° C with 10 mM DTT and alkylated with 15 mM iodoacetamide for 30 minutes at room temperature in the dark. The proteins are then precipitated with the gradual addition of 6 volumes of cold acetone (-20º Celsius) and incubated overnight at -80º Celsius.
[001314] [001314] Proteins are granulated, washed 3 times with methanol! cold (-20º Celsius) and resuspended in 50 mM Tris pH 8. 3.33 µg trypsin / lysC are added to proteins during the first 4 hours of digestion at 37ºC with agitation. The samples are diluted with 50 mM Tris, pH 8 and 0.1% sodium deoxycholate is added with another 3.3 µg of trypsin / lisC for overnight digestion at 37ºC with stirring. Digestion is interrupted and sodium deoxycholate is removed by adding 2% v / v formic acid. The samples are vortexed and cleaned by centrifugation for 1 minute at 13,000 RPM.
[001315] [001315] The proteins are purified by extraction in solid phase in reverse phase (SPE) and dried. The samples are reconstituted in 3% DMSO, 0.2% formic acid in water and analyzed by LC-MS, as previously described.
[001316] [001316] The data resulting from protein quantification are analyzed to determine protein levels and proportions of known exosomal marker proteins. Specifically:
[001317] [001317] Likewise, the molar ratio for all exosomal marker proteins to all measured proteins is determined as the sum of the molar quantity of all the specific exosome marker proteins listed above, divided by the sum of the molar quantities of all the proteins identified in each sample and expressed as one percent of the total.
[001318] [001318] In one embodiment, using this approach, a sample will comprise less than 5% of any individual exosomal marker protein and less than 15% of total exosomal marker proteins.
[001319] [001319] In one embodiment, any individual exosomal marker protein will be present in less than 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5% or 10 %.
[001320] [001320] In one embodiment, the sum of all exosomal marker proteins will be less than 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20% or 25%. EXAMPLE 45: GAPDH MEASUREMENT IN FUSOSOMES
[001321] [001321] This assay describes the quantification of the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in fusosomes and the relative level of GAPDH in fusosomes compared to parent cells
[001322] [001322] GAPDH is measured in parental cells and fusosomes using a commercially available standard ELISA for GAPDH (ab176642, Abcam) according to the manufacturer's instructions.
[001323] [001323] Total protein levels are measured in a similar way using the bicinconinic acid assay, as previously described in the same sample volume used to measure GAPDH. In the modalities, using this assay, the level of GAPDH per total protein in the fusosomes will be <100ng GAPDH / ug of total protein. Likewise, in the modalities, the decrease in GAPDH levels in relation to the total protein of parental cells for fusosomes will be greater than a 10% reduction.
[001324] [001324] In one embodiment, the GAPDH content in the preparation in ng GAPDH / ug of total protein will be less than 500, less than 250, less than 100, less than 50, less than 20, less than 10, less than 5 or less than 1.
[001325] [001325] In one embodiment, the decrease in GAPDH per total protein in ng / ug of the parental cell for the preparation will be greater than 1%, greater than 2.5%, greater than 5%, greater than 10%, greater than 15 %, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80% or more than 90%. EXAMPLE 46: CALNEXIN MEASUREMENT IN FUSOSOMES
[001326] [001326] This assay describes the quantification of the level of calnexin (CNX) in fusosomes and the relative level of CNX in fusosomes compared to parental cells.
[001327] [001327] Calnexin is measured in the initial cells and preparation using a commercially available standard ELISA for calnexin (MBS721668, MyBioSource) according to the manufacturer's instructions.
[001328] [001328] Total protein levels are measured in a similar way
[001329] [001329] In one embodiment, the content of calnexin in the preparation in ng of calnexin / ug of total protein will be less than 500, 250, 100, 50, 20, 10, 50u 1.
[001330] [001330] In one embodiment, the decrease in total protein calnexin in ng / ug of the parental cell for the preparation will be greater than 1%, 2.5%, 5%, 10%, 15%, 20%, 30 %, 40%, 50%, 60%, 70%, 80% or 90%. EXAMPLE 47: COMPARISON OF SOLUBLE PROTEIN MASS THE INSOLUBLE
[001331] [001331] This example describes the quantification of the soluble: insoluble ratio of the mass of proteins in fusosomes. In a modality, the soluble: insoluble ratio of the protein mass in the fusosomes will be similar to the nucleated cells.
[001332] [001332] Fusosomes are prepared by any of the methods described in the previous examples. The fusosome preparation is tested to determine the proportion of soluble: insoluble proteins using a standard bicinconinic acid (BCA) test (for example, using the Pierce'Y BCA Protein Test Kit available on the market, product Thermo Fischer ft 23225). Samples of soluble protein are prepared by suspending the fusosomes or parental cells prepared at a concentration of 1x10º7 cells or fusosomes / ml in PBS and centrifuging at 1,600g to granulate the fusosomes or cells. The supernatant is collected as the fraction of soluble protein.
[001333] [001333] Fusosomes or cells in the granule are lysed by vigorous piping and vortexing in PBS with 2% Triton-X-
[001334] [001334] A standard curve is generated using the supplied BSA, from 0 to 20 µg BSA per well (in triplicate). The preparation of fusosomes or cells is diluted so that the amount measured is within the range of the standards. The fusosome preparation is analyzed in triplicate and the mean value is used. The concentration of soluble protein is divided by the concentration of insoluble protein to produce the proportion of soluble protein: insoluble.
[001335] [001335] In one modality, the rate of soluble protein in spindle sum: insoluble will be within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 90% or more compared to parental cells. EXAMPLE 48: LPS MEASUREMENT IN FUSOSOMES
[001336] [001336] This example describes the quantification of levels of lipo-polysaccharides (LPS) in fusosomes compared to parental cells. In one embodiment, fusosomes will have lower levels of LPS compared to parental cells.
[001337] [001337] LPS is a component of bacterial membranes and a potent inducer of innate immune responses.
[001338] [001338] LPS measurements are based on mass spectrometry, as described in the previous examples.
[001339] [001339] In one embodiment, less than 5%, 1%, 0.5%, 0.01%, 0.005%, 0.0001%, 0.00001% or less of the lipid content of fososomes will be LPS. EXAMPLE 49: REASON FOR LIPIDS AND PROTEINS IN SPINDLES BUT
[001340] [001340] This example describes the quantification of the ratio of lipid mass to protein mass in fusosomes. In a modality
[001341] [001341] The total lipid content is calculated as the sum of the molar content of all lipids identified in the lipid data defined in the previous Example. The total protein content of the fusosomes is measured using the bicinconinic acid assay, as described herein.
[001342] [001342] Alternatively, the ratio of lipids to proteins can be described as a ratio of a specific lipid species to a specific protein. The specific lipid species is selected from the lipidomic data produced in a previous example. The specific protein is selected from the protein data produced in a previous example. Different combinations of species and selected lipid proteins are used to define lipid: specific protein ratios. EXAMPLE 50: REASON FOR PROTEINS FOR DNA IN SPINDLES BUT
[001343] [001343] This example describes the quantification of the ratio between the mass of protein and the mass of DNA in the fusosomes. In a modality, fusosomes will have a ratio of mass of protein to mass of DNA that is much greater than cells.
[001344] [001344] The total protein content of fusosomes and cells is measured as described in a previous Example. The DNA mass of fusosomes and cells is measured as described in a previous example. The ratio of proteins to total nucleic acids is then determined by dividing the total protein content by the total DNA content to produce a ratio within a given range for a typical fusosome preparation.
[001345] [001345] Alternatively, the ratio of proteins to nucleic acids is determined by defining the levels of nucleic acids as the level of a specific gene for house maintenance, such as GAPDH, using semiquantitative real-time PCR (RT-PCR) .
[001346] [001346] The protein to GAPDH nucleic acid ratio is then determined by dividing the total protein content by the total GAPDH DNA content to define a specific protein: nucleic acid range for a typical fusosomal preparation. bad. EXAMPLE 51: REASON FOR LIPIDS IN DNA IN FUSOSOMES
[001347] [001347] This example describes the quantification of the lipid-to-DNA ratio in fusosomes compared to parent cells. In one embodiment, fusosomes will have a higher ratio of lipids to DNA compared to parental cells.
[001348] [001348] This proportion is defined as the total lipid content (described in an example above) or a specific lipid species. In the case of a specific lipid species, the range depends on the specific lipid species selected. The specific lipid species is selected from the lipidomic data produced in the Example described above. The nucleic acid content is determined as described in the Example described above.
[001349] [001349] Different combinations of selected lipid species normalized to the nucleic acid content are used to define lipid: specific nucleic acid relationships that are characteristic of a particular fusosome preparation. EXAMPLE 52: ANALYSIS OF SURFACE MARKERS IN FUSOSOMES
[001350] [001350] This test describes the identification of surface markers in fusosomes.
[001351] [001351] Fusosomes are granulated and sent frozen to the proteomic analysis center by standard procedures for handling biological samples.
[001352] [001352] To identify the presence or absence of surface markers in fusosomes, they are stained with markers against phosphatidyl serine and CD40 ligand and analyzed by flow cytometry using a FACS system (Becton Dickinson). For the detection of surface phosphatidylserine, the product is analyzed with an annexin V assay (556547, BD Biosciences), as described by the manufacturer.
[001353] [001353] Briefly, the fusosomes are washed twice with cold PBS and then resuspended in 1X binding buffer at a concentration of 1x10º6 fusosomes / ml. 10% of the resuspension is transferred to a 5 ml culture tube! and 5 µl of FITC annexin V are added. The cells are gently vortexed and incubated for 15 min at room temperature (25ºC) in the dark.
[001354] [001354] At the same time, 10% separated from the resuspension are transferred to a different tube to act as an unstained control. 1X binding buffer is added to each tube. The samples are analyzed by flow cytometry within 1 hour.
[001355] [001355] In some embodiments, using this assay, the population mean of spotted fusosomes will be determined above the average of the unstained cells, indicating that fusosomes comprise phosphatidyl serine.
[001356] [001356] Likewise, for the CD40 ligand, the following monoclonal antibody is added to another 10% of the washed fusosomes: mouse anti-human TRAP1 CD154 clone PE-CF594 (563589, BD Pharmigen), according to the instructions of the manufacturer. Briefly, saturated amounts of the antibody are used. At the same time, 10% separate from the fusosomes are transferred to a different tube to act as an untainted control. The tubes are centrifuged for 5 minutes at 400 x g, at room temperature. The supernatant is decanted and the granule is washed twice with
[001357] [001357] In one embodiment, using this assay, the average spotted fusosome population will be above the average for the unstained cells, indicating that the fusosomes comprise the CD40 ligand. EXAMPLE 53: ANALYSIS OF VIRAL CAPSIDE PROTEINS IN FUSOSOMES
[001358] [001358] This test describes the analysis of the composition of the sample preparation and assesses the proportion of proteins that are derived from sources of the viral capsid.
[001359] [001359] Fusosomes are granulated and sent frozen to a proteomic analysis center according to standard procedures for handling biological samples.
[001360] [001360] Fusosomes are thawed for protein extraction and analysis. First, they are resuspended in lysis buffer (7M urea, 2M thiourea, 4% (w / v) cracks in 50 mM Tris pH 8.0) and incubated for 15 minutes at room temperature with an occasional vortex. The mixtures are then lysed by sonication for 5 minutes in an ice bath and centrifuged for 5 minutes at 13,000 RPM. The total protein content is determined by a colorimetric assay (Pierce) and 100 µg of protein from each sample is transferred to a new tube and the volume is adjusted with 50 mM Tris pH 8.
[001361] [001361] Proteins are reduced for 15 minutes at 65ºCelsius with 10 mM DTT and alkylated with 15 mM iodoacetamide for 30 minutes at room temperature in the dark. The proteins are then precipitated with the gradual addition of 6 volumes of cold acetone (-20º Celsius) and incubated overnight at -80º Celsius.
[001362] [001362] The proteins are granulated, washed 3 times with cold methanol (-20º Celsius) and resuspended in 50 mM Tris pH 8. 3.33 µg of trypsin / lysC are added to the proteins during the first 4 hours of digestion at 37ºC with agitation. The samples are diluted with 50 mM Tris, pH 8 and 0.1% sodium deoxycholate is added with another 3.3 µg of trypsin / lisC for overnight digestion at 37ºC with stirring. Digestion is interrupted and sodium deoxycholate is removed by adding 2% v / v formic acid. The samples are vortexed and cleaned by centrifugation for 1 minute at 13,000 RPM.
[001363] [001363] Proteins are purified by extraction in solid phase in reverse phase (SPE) and dried. The samples are reconstituted in 3% DMSO, 0.2% formic acid in water and analyzed by LC-MS, as previously described.
[001364] [001364] The molar ratio of viral capsid proteins to all measured proteins is determined as the molar quantity of all viral capsid proteins divided by the sum of the molar quantities of all proteins identified in each sample and expressed in percentage.
[001365] [001365] In one embodiment, using this approach, the sample will comprise less than 10% of viral capsid protein. In one embodiment, the sample will comprise less than 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80% or 90% of viral capsid protein. EXAMPLE 54: FUSION MEASUREMENT WITH A TARGET CELL
[001366] [001366] This example describes the quantification of the spindle-sum fusion with a target cell compared to a non-target cell.
[001367] [001367] In one embodiment, fusosome fusion with a target cell allows cell specific delivery of a charge, transported within the lumen of the fusosome, to the cytosol of the recipient cell. Fusosomes produced by the methods described herein are analyzed for the rate of fusion with a target cell as follows.
[001368] [001368] In this example, the fusosome comprises a HEK293T cell that expresses Myomaker on its plasma membrane. In addition, the fusosome expresses the fluorescent protein mTagBFP2 and the recombinase Cre. The target cell is a myoblast cell, which expresses Myomaker and Myomixer, and the non-target cell is a fibroblast cell, which does not express Myomaker or Myomixer. A summation spindle that expresses Myomaker is expected to fuse with the target cell that expresses both Myomaker and Myomixer but not that of non-target cells (Quinn et al., 2017, Nature Communications, 8, 15665. doi.org/
[001369] [001369] Target or non-target recipient cells are plated on a 96-well black plate with a light background. Target and non-target cells are plated for the different fusion groups. Then, 24 hours after the plating of the recipient cells, the fusosomes expressing the Cre recombinase protein Cre and Myomaker are applied to the target or non-target recipient cells in the DMEM media. The frequency of fusosomes is correlated with the number of receptor cells plated in the well. After applying the fusosomes, the cell plate is centrifuged at 400 g for 5 minutes to help initiate contact between the fusosomes and the recipient cells.
[001370] [001370] From four hours after the application of the fusosome, cell wells are analyzed to positively identify positive cells for RFP versus positive cells for GFP in the field or well.
[001371] [001371] In this example, cell plates are recorded under a microscope - automatic - (www.biotek.com/products/imaging-micros- copy -automated-cell-Iimagers / lionheart-fx-automated-live-cell-imager / ). The total cell population in a given well is determined by first staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by intermingling with DNA and is therefore used to identify individual cells. After staining, Hoechst media is replaced with regular DMEM media.
[001372] [001372] Hoechst is photographed using the LED filter hub and DAP! 405 nm. The GFP is created using the 465 nm LED and GFP filter cube, while the RFP is created using the 523 nm LED and RFP filter cube. Images of target and non-target cell wells are acquired by first establishing the LED intensity and integration times in a positive control well; that is, recipient cells treated with adenovirus that encode Cre recombinase instead of fusosomes.
[001373] [001373] The acquisition settings are defined so that the RFP and GFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest are then imaged using the established settings. Wells are viewed every 4 hours to obtain course time data for melting activity rates.
[001374] [001374] The analysis of positive wells for GFP and RFP is performed with the software provided with the fluorescent microscope or other software (Rasband, WS, ImageyJ, US National Institutes of Health, Bethesda, Maryland, USA, rsb.info .nih.gov / ij /, 1997-2007).
[001375] [001375] The images are pre-processed using a subtraction algorithm of a 60-foot wide rolling ball background. The total cell mask is defined in the Hoechst positive cells. Cells with Hoechst intensity significantly above background intensities are bounded and areas too small or large to be Hoechst positive cells are excluded.
[001376] [001376] Within the total cell mask, positive cells for GFP and RFP are identified by again limiting cells significantly above the bottom and extending Hoechst masks (nuclei) to the entire cell area to include all cell fluorescence from GFP and RFP. The number of positive RFP cells identified in control wells containing target or non-target recipient cells is used to subtract from the number of positive RFP cells in wells containing fusosome (to subtract for non-specific Loxp recombination). The number of positive RFP cells (fused receptor cells) is then divided by the sum of positive GFP cells (non-fused receptor cells) and positive RFP cells each time to quantify the fusosome fusion rate within the population. of recipient cells. The rate is normalized to the determined dose of fusosome applied to the recipient cells. For targeted fusion rates (fusosome fusion for target cells), the fusion rate for the non-target cell is subtracted from the fusion rate for the target cell in order to quantify the targeted fusion rates.
[001377] [001377] In one embodiment, the average fusion rate for spindles with target cells will be in the range of 0.01 to 4.0 RFP / GFP cells per hour for target cell fusion or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than non-target recipient cells with fusosomes. In one embodiment, groups with no fusosome application will show a background rate of <0.01 RFP / GFP cells per hour.
[001378] [001378] This example describes the fusion of the fusosome with a cell in vitro. In one embodiment, fusion of the fusosome with a cell in vitro results in the delivery of an active membrane protein to the recipient cell.
[001379] [001379] In this example, fusosomes are generated from a cell that expresses HEK293T the Sendai virus HVJ-E protein (Tanaka et al., 2015, Gene Therapy, 22 (October 2014), 1-8. Doi.org /
[001380] [001380] Muscle cells, like C2C12 cells, are treated with fusosomes that express GLUTA4, fusosomes that do not express GLUTA, PBS (negative control) or insulin (positive control). GLUTA4 activity in C2C012 cells is measured by the uptake of the fluorescent analog of 2-deoxyglucose, 2- [N- (7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino] -2- deoxyglucose (2-NBDG). The fluorescence of C2C12 cells is assessed by microscopy using the methods described in the previous examples.
[001381] [001381] In one embodiment, C2C12 cells treated with fusosomes that express GLUTA4 and insulin are expected to demonstrate increased fluorescence compared to C2C12 cells treated with PBS or fusosomes that do not express GLUTA.
[001382] [001382] See also Yang et al., Advanced Materials 29, 1605604,
[001383] [001383] This example describes the fusion of the fusosome with a cell in vivo. In one embodiment, fusion of the fusosome with a cell in vivo results in the delivery of an active membrane protein to the recipient cell.
[001384] [001384] In this example, the fusosomes are generated from a HEK293T cell that expresses the HVJ-E protein of the Sendai virus, as in the previous example. In one embodiment, fusosomes are generated to express the membrane protein, GLUT4. Fusosomes with and without GLUTA4 are prepared from HEK293T cells as described by any of the methods described in a previous Example.
[001385] [001385] BALB / c-nu mice are administered fusosomes that express GLUTA, fusosomes that do not express GLUTA4 or PBS (negative control). The mice are injected intramuscularly into the anterior tibial muscle with fusosomes or PBS. Immediately before the fusosome administration, the mice are fasted for 12 hours and injected with [18F] 2-fluoro-2-deoxy-a-glucose (18F-FDG), which is a glucose analog that allows positron tomography (PET image). The mice are injected with 18F-FDG through the tail vein under anesthesia (2% isoflurane). PET imaging is performed using a nanoscale imaging system (11, Mediso, Hungary). The images are taken 4 hours after the administration of the fusosomes. Immediately after the image, the mice are sacrificed and the anterior tibial muscle is weighed. PET images are reconstructed using a 3D image system in full detector mode, with all corrections enabled, high smoothing and eight iterations. The three-dimensional analysis of the volume of interest (VOI) of the reconstructed images is carried out using the image software package (Mediso, Hungary) and applying
[001386] [001386] In one embodiment, mice that are administered with fusosomes that express GLUT4 are expected to demonstrate an increased radioactive signal in VOI compared to mice that administer PBS or fusosomes that do not express GLUTA4.
[001387] [001387] See also Yang et al., Advanced Materials 29, 1605604,
[001388] [001388] This example describes the quantification of fusosome leakage through an endothelial monolayer as tested with an in vitro microfluidic system (JS Joen et al. 2013, newspapers .plos.org / plosone / article Id = 10.1371 / journal .pone.0056910).
[001389] [001389] The cells leak from the vasculature to the surrounding tissue. Without wishing to be limited by theory, extravasation is a way for fusosomes to reach extravascular tissues.
[001390] [001390] The system includes three addressable media channels independently, separated by chambers in which a gel that mimics ECM can be injected. In summary, the microfluidic system has molded PDMS (polydimethyl siloxane; Silgard 184; Dow Chemical, MI) through which the access doors are perforated and connected to a cover glass to form microfluidic channels. The dimensions of the channel cross section are 1 mm (width) by 120 µm (height). To improve matrix adhesion, the PDMS channels are coated with a PDL solution (poly-D-lysine hydrobromide; 1 mg / ml; Sigma-
[001391] [001391] Next, the collagen type solution | (BD Biosciences, San Jose, CA, USA) (2.0 mg / ml) with phosphate buffered saline (PBS; Gibco) and NaOH is injected into the gel regions of the device through four separate filling ports and incubated for 30 min to form a hydrogel. When the gel is polymerized, the endothelial cell medium (purchased from suppliers such as Lonza or Sigma) is immediately pipetted into the channels to prevent dehydration of the gel. When vacuuming the medium, the diluted hydrogel solution (BD science) (3.0 mg / ml) is introduced into the cell channel and the excess hydrogel solution is washed with cold medium.
[001392] [001392] Endothelial cells are introduced into the middle channel and allowed to settle to form an endothelium. Two days after endothelial cell seeding, fusosome cells or macrophages (positive control) are introduced into the same channel in which the endothelial cells formed a complete monolayer. Fusosomes are introduced to adhere and transmigrate through the monolayer to the gel region. The cultures are kept in a humidified incubator at 37ºC and 5% CO> 2. A version of the fusosome that expresses GFP is used to allow images of living cells by fluorescent microscopy. The next day, the cells are fixed and stained for nuclei using DAP staining! in the chamber, and several regions of interest are photographed using a confocal microscope to determine how many fusosomes have passed through the endothelial monolayer.
[001393] [001393] In one embodiment, DAPI staining will indicate that fusosomes and positive control cells are able to pass through the endothelial barrier after sowing. EXAMPLE 58: MEASUREMENT OF CHEMICAL CELL MOBILITY TACTICS
[001394] [001394] This example describes the quantification of fusosome chemotaxis. Cells can move towards or move away from a chemical gradient via chemotaxis. In one embodiment, chemo-taxonomy will allow fusosomes to accommodate a lesion site or track a pathogen. A purified fusosome composition as produced by any of the methods described in the previous Examples is tested for its chemotactic abilities as follows.
[001395] [001395] A sufficient number of fusosome or macrophage cells (positive control) is loaded into a micro-slide well according to the protocol provided by the manufacturer on the DMEM media (ibidi.com/img/cms/products / labware / channel slides / S 8032X Chemotaxi S / IN 8032X Chemotaxis.pdf). Fusosomes are left at 37ºC and 5% CO for 1 h. After cell binding, DMEM (negative control) or chemo attractant MCP1 containing DMEM are loaded into adjacent reservoirs of the central channel and the fusosomes are recorded continuously for 2 hours using a wide-field inverted Zeiss microscope. The images are analyzed using the ImageGeJ software (Rasband, WS, ImageJ, US National Institutes of Health, Bethesda, Maryland, USA, http://rsb.info.nih.gov/ijf, 1997-2007). The migration coordination data for each observed fusosome or cell is acquired with the manual tracking plug-in (Fbrice Cordeliêres, Institut Curie, Orsay, France). Chemotherapy charts and migration speeds are determined using the Chemotaxis and Migration Tool (ibidi).
[001396] [001396] In one mode, the accumulated average distance and the migration speed of the fusosomes will be within 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or greater than the response of positive control cells to chemokine. The response of cells to a chemokine is described, for example, in Howard E. Gendelman et al., Journal of Neuroimmune Pharmacology,
[001397] [001397] This Example describes return of fusosomes to an injury site. Cells can migrate from a distal location and / or accumulate on a specific site, for example, a site’s home location. The site is usually a site of injury. In one modality, fososomes harbor, for example, migrate to or accumulate in an injury site.
[001398] [001398] Eight-week-old C57BL / 6J mice (Jackson Laboratories) are dosed with notexin (NTX) (Accurate Chemical & Scientific Corp), a myotoxin, in sterile saline by intramuscular injection (IM) using a 30G needle in the right anterior tibial (TA) muscle at a concentration of 2 µg / ml. The skin over the anterior tibial muscle (TA) is prepared by shaving the area using a chemical hair remover for 45 seconds, followed by 3 washes with water. This concentration is chosen to ensure maximum myofiber de- generation, in addition to minimal damage to satellite cells, motor axons and blood vessels.
[001399] [001399] On day 1 after the NTX injection, the mice receive an intravenous injection of fusosomes or cells that express firefly luciferase. Fusosomes are produced from cells that stably express firefly luciferase by any of the methods described in the previous examples. A bioluminescent imaging system (Perkin Elmer) is used to obtain images of entire bioluminescent animals at 0, 1, 3,7,21 and 28 after injection.
[001400] [001400] Five minutes before the image, the mice receive an intraperitoneal injection of bioluminescent substrate (Perkin Elmer) at a dose of 150 mg / kg, in order to visualize the luciferase. The imaging system is calibrated to compensate for all device configurations. The bioluminescent signal is measured using Radiance Photons, with full flow used as a measured value. The region of interest (RO!) Is generated by surrounding the ROI signal to provide a value in photons / second. An RO! is evaluated both in the NTX-treated TA muscle and in the contralateral TA muscle, and the photon / second ratio between NTX-treated and non-NTX-treated TA muscles is calculated as a measure of return to the NTX-treated muscle .
[001401] [001401] In one embodiment, the proportion of photons / second between TA muscles treated with NTX and untreated with NTX in spindles and cells will be greater than 1 indicating specific accumulation of fusosomes that express luciferase in the lesion.
[001402] [001402] See, for example, Plant et al., Muscle Nerve 34 (5) L 577 to 585, 2006. EXAMPLE 60: MEASUREMENT OF PAGOCYTIC ACTIVITY
[001403] [001403] This example demonstrates the phagocytic activity of spindles. In one embodiment, fusosomes have phagocytic activity, for example, they are capable of phagocytosis. The cells become involved in phagocytosis, swallowing particles, allowing the sequestration and destruction of foreign invaders, such as bacteria or dead cells.
[001404] [001404] A purified fusosome composition as produced by any of the methods described in the previous Examples comprising a fusosome of a mammal macrophage with partial or complete nuclear inactivation was capable of phagocytosis tested by pathogen bioparticles. This estimate was made using a fluorescent phagocytosis assay according to the following protocol.
[001405] [001405] Macrophages (positive control) and fusosomes were sown immediately after collection in separate confocal plates with glass bottom. Macrophages and fusosomes were incubated in DMEM + 10% FBS + 1% P / S for 1h. Fluorescence-labeled E. coli KI2 and non-fluorescein-labeled Escherichia coli K-12 (negative control) were added to macrophages / fusosomes, as indicated in the manufacturer's protocol, and were incubated for 2 hours, tools.thermofisher.com / content / sfs / manuals / mp06694 .pdf. After 2 h, the free fluorescent particles were quenched by adding trypan blue. The intracellular fluorescence emitted by particles involved was analyzed by confocal microscopy at 488 excitations. The number of positive phagocytic fusosomes was quantified using the image J software.
[001406] [001406] The average number of phagocytotic fusosomes was at least 30% 2h after the introduction of bioparticles and was greater than 30% in the positive control macrophages. EXAMPLE 61: MEASURING THE CAPACITY TO CROSS A CELL MEMBRANE OR THE HEMATOENCEPHALIC BARRIER
[001407] [001407] This example describes the quantification of fusosomes that cross (the blood-brain barrier). In one embodiment, the fusosomes will cross, for example, enter and exit the cerebral blood barrier, for example, for delivery to the central nervous system.
[001408] [001408] Eight-week-old C57BL / 6J mice (Jackson Laboratories) are injected intravenously with spindle sums or leukocytes (positive control) that express firefly luciferase. Fusosomes are produced from cells that stably express firefly luciferase or cells that do not express luciferase (negative control) by any of the methods described in the previous Examples. A bioluminescent imaging system (Perkin Elmer) is used to obtain bioluminescent images in whole animals at one, two, three, four, five, six, eight, twelve and twenty-four hours after the injection of fusosome or cell.
[001409] [001409] Five minutes before the image, the mice receive an intraperitoneal injection of bioluminescent substrate (Perkin El-
[001410] [001410] In one mode, the photons / second in the RO! they will be larger in animals injected with cells or fusosomes that express luciferase than negative control fusosomes that do not express luciferase indicating accumulation of fusosomes that express luciferase in or around the brain. EXAMPLE 62: MEASUREMENT OF PROTECTION SECRETATION POTENTIAL THEINES
[001411] [001411] This example describes the quantification of secretion by fusosomes. In one embodiment, fusosomes will be capable of secreting, for example, protein secretion. The cells can discard or discharge the material by secretion. In one embodiment, fusosomes interact chemically and communicate in their environment via secretion.
[001412] [001412] The ability of fusosomes to secrete a protein at a given rate is determined using the ThermoFisher Scientific Gaussia luciferase flash assay (catalog number 16158). Cells of mouse embryonic fibroblasts (positive control) or fusosomes, produced by any of the methods described in the previous examples, are incubated in growth media and samples of the media are collected every 15 minutes, first granulating the fusosomes at 1,600 g for 5 minutes and then collecting the supernatants. The collected samples are pipetted into a 96-well titration plate with a transparent bottom. A working buffer solution is then prepared according to the manufacturer's instructions.
[001413] [001413] Briefly, colenterazine, a luciferin or light-emitting molecule, is mixed with instant assay buffer and the mixture is pipetted into each well of the 96-well titration plate containing samples. Negative control wells that lack cells or fusosomes include growth medium or assay buffer to determine the background Gaussian luciferase signal. In addition, a standard curve of purified Gaussia luciferase (Athena Enzyme Systems, catalog number 0308) is prepared to convert the luminescence signal into Gaussian luciferase secretion molecules per hour.
[001414] [001414] The plate is tested for luminescence, using the 500 ms integration. Background of the Gaussian luciferase signal is subtracted from all samples, and then a best-fit linear curve is calculated for the standard Gaussian luciferase curve. If the sample readings do not fit the standard curve, they will be diluted accordingly and analyzed again. Using this assay, the ability of fusosomes to secrete Gaussia luciferase at a rate (molecules / hour) within a given range is determined.
[001415] [001415] In one embodiment, fusosomes will be able to secrete proteins at a rate of 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than positive control cells. EXAMPLE 63: MEASURING THE TRANSDUCTION POTENTIAL OF SIGNAL
[001416] [001416] This example describes the quantification of signal transduction in fusosomes. In one embodiment, fusosomes are capable of signal transduction. Cells can send and receive molecular signals from the extracellular environment through signaling cascades, such as phosphorylation, in a process known as signal transduction. A purified fusosome composition as produced by any of the methods described in the previous Examples comprising a fusosome of a mammalian cell with partial or complete nuclear inactivation is capable of insulin-induced signal transduction. Insulin-induced signal transduction is assessed by measuring AKT phosphorylation levels, an important pathway in insulin receptor signaling and glucose uptake in response to insulin.
[001417] [001417] To measure AKT phosphorylation, cells, for example, embryonic mouse fibroblasts (MEFs) (positive control), and fusosomes are plated in 48-well plates and left for 2 hours in a humidified incubator at 37ºC and 5% CO ,. After cell adhesion, insulin (for example, at 10 nM), or a negative control solution without insulin, is added to the well containing cells or fusosomes for 30 min. After 30 minutes, protein lysate is produced from fusosomes or cells, and phospho-AKT levels are measured by Western blotting in insulin-stimulated samples and in the control of unstimulated samples.
[001418] [001418] Glucose uptake in response to insulin or negative control solution is measured as explained in the glucose uptake section using labeled glucose (2-NBDG). (S. Galic et al., Molecular Cell Biology 25 (2): 819 to 829, 2005).
[001419] [001419] In one embodiment, fusosomes will increase AKT phosphorylation and glucose uptake in response to insulin over negative controls by at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or higher.
[001420] [001420] This Example describes the quantification of the levels of a 2-NBDG (2- (N- (7-nitrobenz-2-0xa-1,3-diazol-4-yl) amino) -2-Deoxyglucose) a fluorescent glucose analog that can be used to monitor the uptake of glucose in living cells and thus measure active transport through the lipid bilayer. In one embodiment, this assay can be used to measure the level of glucose uptake and active transport through the lipid bilayer of the fusosome.
[001421] [001421] A fusosome composition is produced by any of the methods described in the previous Examples. A sufficient number of fusosomes are then incubated in DMEM without glucose, 20% Bovine Fetal Serum and 1x Penicillin / Streptomycin, for 2 hours at 37ºC and 5% CO ». After a period of 2 hours of glucose starvation, the medium is changed to include DMEM without glycoside, 20% fetal bovine serum, 1x penicillin / streptomycin and 20 µM of 2 NBDG (ThermofFisher) and incubated for another 2 h at 37ºC and 5% CO ».
[001422] [001422] Negative control fusosomes are treated in the same way, except that an equal amount of DMSO is added in place of 2-NBDG.
[001423] [001423] Fusosomes are washed three times with 1xPBS and resuspended in an appropriate buffer and transferred to a 96-well imaging plate. The fluorescence of 2-NBDG is then measured on a fluorimeter using a GFP light cube (excitation filter 469/35 and an emission filter 525/39) to quantify the amount of 2-NBDG that has been transported across the fusosome membrane and accumulated in the fusosome within 1 hour of loading.
[001424] [001424] In one embodiment, 2-NBDG fluorescence will be greater in the fusosome with 2-NBDG treatment, compared to the negative control (DMSO). Fluorescence measured with an emission filter
[001425] [001425] This example assesses the miscibility of a spindle-lumen lumen with aqueous solutions, such as water.
[001426] [001426] Fusosomes are prepared as described in the previous examples. Controls are dialysis membranes with hypotonic solution, hyperosmotic solution or normal osmotic solutions.
[001427] [001427] Fusosomes, positive control (normal osmotic solution) and negative control (hypotonic solution) are incubated with hypotonic solution (150 mOsmol). The cell size is measured under a microscope after each sample is exposed to the aqueous solution. In one embodiment, the sizes of the fusosome and positive control in the hypotonic solution increase compared to the negative control.
[001428] [001428] Fusosomes, positive control (normal osmotic solution) and negative control (hyperosmotic solution) are incubated with a hyperosmotic solution (400 mOsmol). The cell size is measured under a microscope after each sample is exposed to the aqueous solution. In one embodiment, the size of the fusosome and positive control in the hyperosmotic solution will decrease compared to the negative control.
[001429] [001429] Fusosomes, positive control (hypotonic or hyposrosmotic solution) and negative control (normal osmotic) are incubated with a normal osmotic solution (290 mOsmol). The cell size is measured under a microscope after each sample is exposed to the aqueous solution. In one embodiment, the spindle-sum and positive control sizes in the normal osmotic solution will remain substantially the same compared to the negative control.
[001430] [001430] This example describes the quantification of esterase activity, as a substitute for metabolic activity, in fusosomes. Cytosolic esterase activity in fusosomes is determined by quantitative evaluation of staining with calcein-AM (Bratosin et al., Cytometry 66 (1): 78 to 84, 2005).
[001431] [001431] The membrane-permeable dye, calcein-AM (Molecular Probes, Eugene OR USA), is prepared as a stock solution of mM in dimethylsulfoxide and as a working solution of 100 mM in PBS buffer, pH 7.4. Fusosomes produced by any of the methods described in the previous examples or positive control parental embryonic fibroblast cells are suspended in PBS buffer and incubated for 30 minutes with calcein-AM working solution (final concentration in calcein-AM: 5 mM ) at 37ºC in the dark and then diluted in PBS buffer for immediate analysis by flow cytometry of calcein fluorescence retention.
[001432] [001432] Fusosomes and parental control mouse embryonic fibroblast cells are experimentally permeabilized as a negative control for zero esterase activity with saponin, as described in (Jacob et al., Cytometry 12 (6): 550 558, 1991). Fusosomes and cells are incubated for 15 min in a 1% saponin solution in PBS buffer, pH 7.4, containing 0.05% sodium azide. Due to the reversible nature of the plasma membrane permeabilization, saponin is included in all buffers used for additional staining and washing steps. After saponin permeability, the fusosomes and cells are suspended in PBS buffer containing 0.1% saponin and 0.05% sodium azide and incubated (37ºC in the dark for 45 min) with calcein-AM to a concentration end of 5 mM, washed three times with the same
[001433] [001433] In one embodiment, a fusosome preparation will have between 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 90%, 100% or more of esterase activity compared to the positive control cell.
[001434] [001434] See also Bratosin D, Mitrofan L, Palii C, Estaquier J, Montreuil J. New fluorescence assay using calcein-AM to determine the viability and aging of human erythrocytes. Cytometry A. July 2005; 66 (1): 78 to 84; and Jacob BC, Favre M, Bensa JC. Permeabilization of membrane cells with saponin and multiparametric analysis by flow cytometry. Cytometry 1991; 12: 550 to 558.
[001435] [001435] Acetylcholinesterase activity is measured using a kit (MAK119, SIGMA) that follows a procedure previously described (Ellman, et al., Biochem. Pharmacol. 7, 88, 1961) and following the manufacturer's recommendations.
[001436] [001436] Briefly, the fusosomes are suspended in 1.25 mM acetylthiocholine in PBS, pH 8, mixed with 0.1 mM 5.5-dithio-bis (2-nitrobenzoic acid) in PBS, pH 7. Incubation it is carried out at room temperature, but the fusosomes and the substrate solution are preheated to 37ºC for 10 minutes before starting the optical density readings.
[001437] [001437] Changes in absorption are monitored at 450 nm per min with a plate reading spectrophotometer (ELX808, BIO-TEK instruments, Winooski, VT, USA). Separately, a sample is used to determine the protein content of the fusosomes using the bicinconinic acid assay for normalization. Using this assay, fusosomes are determined to have <100 units of AChE activity / ug of protein.
[001438] [001438] In one embodiment, the AChE / ug activity units of protein values will be less than 0.001, 0.01, 0.1, 1, 10, 100 or
[001439] [001439] This example describes the quantification of the measurement of citrate synthase activity in fusosomes.
[001440] [001440] Citrate synthase is an enzyme in the tricarboxylic acid (TCA) cycle that catalyzes the reaction between oxaloacetate (OAA) and acetyl-CoA to generate citrate. After the hydrolysis of acetyl-CoA, there is a release of CoA with a thiol group (COA-SH). The thiol group reacts with a chemical reagent, 5,5-Dithiobis- (2-nitrobenzoic acid) (DTNB), to form 5-thio-2-nitrobenzoic acid (TNB), which is a yellow product that can be measured spectrophotometrically at 412 nm (Green 2008). Commercially available kits, such as the Abcam Citrate Human Citrate Activity Assay Kit (Product No. ab119692), provide all the reagents necessary to perform this measurement.
[001441] [001441] The test is performed according to the manufacturer's recommendations. Lysates from fusosome samples are prepared by collecting the fusosomes produced by any of the methods described in the previous Examples and solubilizing them in Extraction Buffer (Abcam) for 20 minutes on ice. The supernatants are collected after centrifugation and the protein content is evaluated by the bicinconinic acid test (BCA, ThermoFisher Scientific) and the preparation remains on ice until the beginning of the following quantification protocol.
[001442] [001442] Briefly, the samples of fusosome lysate are diluted in 1X incubation buffer (Abcam) in the microplate wells provided, with a set of wells receiving only 1X incubation buffer. The plate is sealed and incubated for 4 hours at room temperature with shaking at 300 rpm. The buffer is then aspirated from the wells and the 1X wash buffer is added. This washing step is repeated once more. Then, the 1X Activity solution is added to each well and the plate is analyzed in a microplate reader measuring absorbance at 412 nm every 20 seconds for 30 minutes, with stirring between readings.
[001443] [001443] Background values (wells with only 1X incubation buffer) are subtracted from all wells, and citrate synthase activity is expressed as the change in absorbance per minute per ug of loaded fusosome lysate sample (AMOD (Q 412nm / min / ug of protein.) Only the linear 100- to 400-second portion of the kinetic measurement is used to calculate activity.
[001444] [001444] In one embodiment, a fusosome preparation will have between
[001445] [001445] See, for example, Green HJ et al. Metabolic, enzymatic and carrier response in the human muscle for three consecutive days of exercise and recovery. Am J Physiol Regul Integr Comp Physiol 295: R1238-R1250, 2008. EXAMPLE 69: MEASUREMENT OF BREATHING LEVELS
[001446] [001446] This example describes the quantification of the measurement of respiration level in fusosomes. The level of respiration in the cells can be a measure of oxygen consumption, which potentiates metabolism. Fusosome respiration is measured for oxygen consumption rates by an extracellular flow analyzer Seahorse (Agilent) (Zhang 2012).
[001447] [001447] Fusosomes produced by any of the methods described in the Examples or previous cells are seeded on a 96-well Seahorse microplate (Agilent). The microplate is centrifuged briefly to granulate the fusosomes and the cells at the bottom of the wells. The oxygen consumption tests are initiated by removing the growth medium, replacing it with a minimum DMEM medium with a low buffer containing 25mM glucose and 2mM glutamine (Agilent) and incubating the microplate at 37ºC for 60 minutes to allow balance of temperature and pH.
[001448] [001448] The microplate is then analyzed on an extracellular flow analyzer (Agilent) that measures changes in extracellular oxygen and the pH of the media immediately around the fusosomes and adherent cells. After obtaining steady-state oxygen consumption (baseline respiratory rate) and extracellular acidification rates, oligomycin (5 µM) is added, which inhibits ATP synthase, and the proton ionophore FCCP (carbonyl 4- cyanide (triluoromethoxy) ) phenylhydrazone; 2 µM), which decouples mitochondria, are added to each well in the microplate to obtain values for maximum oxygen consumption rates.
[001449] [001449] Finally, 5 µM of antimycin A (inhibitor of the mitochondrial | complex) is added to confirm that the respiratory changes are mainly due to mitochondrial respiration. The minimum rate of oxygen consumption after adding antimycin A is subtracted from all oxygen consumption measurements to remove the non-mitochondrial respiration component. Samples of cells that do not respond adequately to oligomycin (at least a 25% reduction in the rate of oxygen consumption compared to baseline) or FCCP (at least a 50% increase in the rate of oxygen consumption after oligomycin) are excluded from the analysis. The respiration level of the fososomes is then measured as pmol O2 / min / 1e4 fusosomes.
[001450] [001450] This respiration level is then normalized to the respective cellular respiration level. In one embodiment, fusosomes will have at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, Breathing level 100% or higher compared to the respective cell samples.
[001451] [001451] See, for example, Zhang J, Nuebel E, Wisidagama DRR, et al. Measure energy metabolism in cultured cells, including human pluripotent stem cells and differentiated cells. I protect them from nature. 2012; 7 (6): 10.1038 / nprot.2012.048. doi: 10.1038 / nprot.2012.048. EXAMPLE 70: MEASUREMENT OF PHOSPHATIDYLSERINE LEVELS OF FUSOSOMES
[001452] [001452] This example describes the quantification of the level of attachment of annexin-V to the surface of the fusosomes.
[001453] [001453] Dying cells can exhibit phosphatidylserine on the cell surface, which is a marker of apoptosis in the programmed cell death pathway. Annexin-V binds to phosphatidylserine and, therefore,
[001454] [001454] Fusosomes were produced as described herein. To detect signs of apoptosis, fusosomes or positive control cells were stained with 5% annexin V fluor 594 (A13203, Thermo Fisher, Waltham, MA). Each group (detailed in the table below) included an experimental branch that was treated with an apoptosis inducer, menadione. Menadione was added to 100 µM menadione for 4 h. All samples were run in a flow cytometer (Thermo Fisher, Waltham, MA) and the fluorescence intensity was measured with the YL1 laser at a wavelength of 561 nm and an emission filter of 585/16 nm . The presence of extracellular phosphatidyl serine was quantified by comparing the fluorescence intensity of annexin V in all groups.
[001455] [001455] Unstained fusosomes from the negative control were not positive for annexin V staining.
[001456] [001456] In one embodiment, fusosomes were able to positively regulate the display of phosphatidylserine on the cell surface in response to menadione, indicating that fusosomes not stimulated by menadione are not undergoing apoptosis. In one mode, positive control cells that were stimulated with mezione showed higher levels of staining with annexin V than fusosomes not stimulated with menadione. TABLE 10: ANNEXINE V COLORING PARAMETER annexin V sign (and standard deviation) negative (positive control)
[001457] [001457] This example describes the quantification of justacrine signaling in fusosomes.
[001458] [001458] Cells can form cell-dependent signaling via justacrine signaling. In one embodiment, the presence of justacrine signaling in fusosomes will demonstrate that fososomes can stimulate, suppress and generally communicate with cells in their immediate vicinity.
[001459] [001459] Fusosomes produced by any of the methods described in the previous Examples from mammalian bone marrow stromal cells (BMSCs) with partial or complete nuclear inactivation trigger the secretion of IL-6 via fair signal in macrophages. Primary macrophages and BMSCs are co-cultured. Bone marrow-derived macrophages are first seeded in 6-well plates and incubated for 24 hours; then, primary fusosomes derived from BMSC or mouse BMSC cells (positive control parental cells) are placed on the macrophages in a DMEM medium with 10% SFB. The supernatant is collected at different times (2, 4, 6, 24 hours) and analyzed for IL-6 secretion by the ELISA test. (Chang J. et al., 2015).
[001460] [001460] In one embodiment, the level of justotocrine signaling induced by BMSC fusosomes is measured by an increase in the levels of IL-6 secreted by macrophages in the media. In one embodiment, the level of juxtacrine signaling will be at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or higher than the levels induced by positive control bone marrow stromal cells (BMSCs). EXAMPLE 72: MEASUREMENT OF PARACRINE SIGNAL LEVELS
[001461] [001461] This example describes the quantification of signaling for
[001462] [001462] The cells can communicate with other cells in the local microenvironment by means of paracrine signaling. In a modality, fusosomes will be capable of paracrine signaling, for example, to communicate with cells in their local environment. In one embodiment, the ability of fusosomes to trigger Ca * Signaling in endothelial cells by secretion derived from paracrine with the following protocol will measure Ca * Signaling through the calcium indicator fluo-4 AM.
[001463] [001463] To prepare the experimental plate, the murine pulmonary microvascular endothelial cells (MPMVECs) are placed on a 25 mm glass bottom confocal plate coated with 0.2% geoline (80% confluence). MPMVECs are incubated at room temperature for 30 min in ECM containing 2% BSA and 0.003% pluronic acid with 5 µM of final fluoro-4 AM concentration (Invitrogen) to allow the loading of fluoro-4 AM. After loading, MPMVECs are washed with an experimental imaging solution (ECM containing 0.25% BSA) containing sulfinpyrazone to minimize dye loss. After loading the fluo-4, 500yul of pre-heated experimental imaging solution is added to the plate and the plate is generated by a Zeiss confocal imaging system.
[001464] [001464] In a separate tube, freshly isolated murine macrophages are treated with 1 µg / ml LPS in culture medium (DMEM + 10% FBS) or untreated with LPS (negative control). After stimulation, fusosomes are generated from macrophages by any of the methods described in the previous Examples.
[001465] [001465] Parental fusosomes or macrophages (positive control) are then marked with a red cell tracker, CMTPX (Invitrogen), on the ECM containing 2% BSA and 0.003% pluronic acid. Fusosomes and macrophages are then washed and resuspended in
[001466] [001466] The green and red fluorescence signal is recorded every 3 seconds for 10 to 20 min, using the Zeiss confocal imaging system with an argon ion laser source with excitation at 488 and 561 nm for fluo-4 AM and fluorescence red of the cell tracker, respectively. Changes in fluorescence intensity of Fluo-4 are analyzed using the image software (Mallilankaraman, K. et al., J Vis Exp. (58): 3511, 2011). The level of intensity of Fluo-4 measured in the fusosome groups and negative control cells is subtracted from the fusosome groups and cells stimulated by LPS.
[001467] [001467] In one embodiment, fusosomes, for example, activated fusosomes, will induce an increase in the fluorescence intensity of Fluo-4 which is at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or greater than positive control cell groups. EXAMPLE 73: MEASURING THE CAPACITY TO POLYMERIZE AC- MOBILITY TINA
[001468] [001468] This example describes the quantification of cytoskeletal components, such as actin, in fusosomes. In one embodiment, fusosomes comprise cytoskeletal components, such as actin, and are capable of polymerizing actin.
[001469] [001469] The cells use actin, which is a cytoskeletal component, for motility and other cytoplasmic processes. Cytoskeleton is essential to create driving forces and coordinate the movement process
[001470] [001470] C2C12 cells were enucleated as described herein. Fusosomes obtained from the 12.5% and 15% Ficoll layers were assembled and labeled 'Light', while fusosomes from the 16 to 17% layers were assembled and labeled 'Medium'. Fososomes or cells (parental C2C12 cells, positive control) were resuspended in DMEM + Glutamax + 10% Bovine Fetal Serum (FBS), seeded in 24-well ultra-low insertion plates (ft 3473, Corning Inc, Corning, NY) and incubated at 37 ºC + 5% CO> 2. The samples were collected periodically (5.25h, 8.75h, 26.5h) and stained with rhodamine phalloidin at 165 uM (the negative control was not stained) and measured on a flow cytometer (% * A24858, Thermo Fisher, Waltham, MA) with an FC YL1 laser (561 nm with filter 585/16) to measure the content of the actin-F cytoskeleton. The fluorescence intensity of rhodamine phalloidin in the fusosomes was measured along with the spotted fusosomes and the spotted parental C2C12 cells.
[001471] [001471] The fluorescence intensity of the fusosome was higher (Figure 4) than the negative control at all times, and the spindles were able to polymerize actin at a rate similar to parental C2C12 cells.
[001472] [001472] Additional cytoskeletal components, such as those listed in the table below, are measured by a commercially available ELISA system (Cell Signaling Technology and MyBioSource), according to the manufacturer's instructions. TABLE 11: Cytoskeletal components cheletic measure actin total of Path Scan Arp2 / 3 ELISA KIT of the sub- com | MyBioSource, plexus 2/3 of the related protein | MBS7224740
[001473] [001473] Then, 100 µl of properly diluted lysate is added to the appropriate well of the microwell strips. The microwells are sealed with tape and incubated for 2 hours at 37ºC. After incubation, the sealing tape is removed and the contents are discarded. Each microwell is washed four times with 200 ul of 1X wash buffer. After each individual wash, the plates are tapped on an absorbent cloth so that the residual wash solution is removed from each well. However, the wells are not completely dry at any time during the experiment.
[001474] [001474] Then, 100 μl of the reconstituted Detection Antibody (green) is added to each individual well, except in the negative control wells. Then, the wells are sealed and incubated for 1 hour at 37ºC. The washing procedure is repeated after the incubation is completed. 100 µl of constituted HRP-linked secondary antibody (red) is added to each of the wells. The wells are sealed with tape and incubated for 30 minutes at 37ºC. The sealing tape is then removed and the washing procedure is repeated. 100 µl of TMB substrate is then added to each well. The wells are sealed with adhesive tape and incubated for 10 minutes at 37ºC. Once the final incubation is complete, 100 µl of STOP solution is added to each well and the plate is gently shaken for several seconds.
[001475] [001475] The spectrophotometric analysis of the assay is performed within 30 minutes after adding the STOP solution. The bottom of the wells is cleaned with lint-free tissue and then the absorbance is read at 450 nm. In one embodiment, samples of fusosome that have been stained with the detection antibody absorb more light at 450 nm than control samples of negative fusosomes and absorb less light than samples of cells that have been stained with the detection antibody. EXAMPLE 74: MEASUREMENT OF THE AVERAGE POTENTIAL OF THE MEMBRANE
[001476] [001476] This example describes the quantification of the potential of the mitochondrial membrane of fusosomes. In one embodiment, fososomes comprising a mitochondrial membrane will maintain the potential of the mitochondrial membrane.
[001477] [001477] Mitochondrial metabolic activity can be measured by the potential of the mitochondrial membrane. The membrane potential of the fusosome preparation is quantified using a commercially available dye, TMRE, to assess the mitochondrial membrane potential (TMRE: tetramethyl rhodamine, ethyl ester, perchlorate, Abcam, Catalog No. T669).
[001478] [001478] Fusosomes are generated by any of the methods described in the previous examples. Fusosomes or parent cells are diluted in growth medium (DMEM free of phenol red with 10% fetal bovine serum) in 6 aliquots (untreated triplicates and treated with FCCP). An aliquot of the samples is incubated with FCCP, an uncoupler that eliminates the potential of the mitochondrial membrane and prevents staining of the TMRE. For samples treated with FCCP, 2 µM of FCCP is added to the samples and incubated for 5 minutes before analysis. Fusosomes and parental cells are then stained with 30nM TMRE. For each sample, an untainted sample (without TMRE) is also prepared in parallel. The samples are incubated at 37ºC for 30 minutes. The samples are then analyzed in a flow cytometer with a 488 nm argon laser, and excitation and emission are collected at 530 +/- 30 nm.
[001479] [001479] Potential membrane values (in millivolts, mV) are calculated based on the intensity of the TMRE. All events are captured in the front and side dispersion channels (alternatively, a gate can be applied to exclude small debris). The fluorescence intensity (FI) value for samples not treated and treated with FCCP is normalized by subtracting the geometric mean of the fluorescence intensity of the untainted sample from the geometric mean of the untreated and treated with FCCP sample. The potential state of the membrane for each preparation is calculated using the normalized values of fluorescent intensity with a modified Nernst equation (see below) that can be used to determine the mitochondrial membrane potential of fusosomes or cells based on fluorescence. of TMRE (as TMRE accumulates in mitochondria in a Nernstian way).
[001480] [001480] The potential of the fusosome or cell membrane is calculated with the following formula: (mV) = -61.5 * log (normalized without FI treatment / standardized with FIFCCP). In one embodiment, using this assay in fusosome preparations from C2C12 mouse myoblast cells, the potential membrane state of the fusosome preparation will be within about 1%, 2%, 3%, 4% , 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than parental cells. In one embodiment, the membrane potential range is about -20 to -150mV.
[001481] [001481] This example describes the measurement of the fusosome half-life.
[001482] [001482] Fusosomes are derived from cells expressing Gaussia luciferase produced by any of the methods described in the previous Examples, and pure dilutions of 1: 2, 1: 5 and 1:10 are made in buffered solution. A buffered solution without fusosomes is used as a negative control.
[001483] [001483] Each dose is administered intravenously to three eight-week-old male C57BL / 6J mice (Jackson Laboratories). Blood is collected from the retro-orbital vein at 1,2,3,4, 5, 6, 12, 24, 48 and 72 hours after the intravenous administration of the fososomes. The animals are sacrificed at the end of the experiment by CO inhalation ».
[001484] [001484] The blood is centrifuged for 20 minutes at room temperature. The serum samples are frozen immediately at - 80ºC until bioanalysis. Then, each blood sample is used to perform a Gaussia luciferase activity assay after mixing the samples with the Gaussia luciferase substrate (Nasolight, Pinetop, AZ). Briefly, colenterazine, a luciferin or light-emitting molecule, is mixed with instant assay buffer and the mixture is pipetted into wells containing blood samples in a 96-well titration plate. Negative control wells that do not contain blood contain assay buffer to determine the background Gaussian luciferase signal.
[001485] [001485] In addition, a standard curve of the positive-control purified Gaussia luciferase (Athena Enzyme Systems, catalog number 0308) is prepared to convert the luminescence signal into molecules of Gaussia luciferase secretion per hour. The plate is tested for luminescence, using the 500 ms integration. In advance
[001486] [001486] In one embodiment, fusosomes will have a half-life of at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 290%, 100% or more than the negative control cells. EXAMPLE 76: MEASUREMENT OF FUSOSOMES RETENTION IN CIRCULATION
[001487] [001487] This example describes the quantification of fossa delivery in the circulation and retention in the organs. In one embodiment, the fusosomes are delivered into circulation and are not captured and retained at organ sites.
[001488] [001488] In one embodiment, the fusosomes delivered in the peripheral circulation avoid capture and retention by the reticuloendothelial system (RES), in order to reach the target sites with high efficiency. The RES comprises a system of cells, mainly macrophages, that reside in solid organs, such as the spleen, lymph nodes and liver. These cells are usually tasked with removing "old" cells, such as red blood cells.
[001489] [001489] Fusosomes are derived from cells that express CRE recombinase (agent) or cells that do not express CRE (con-
[001490] [001490] The recipient mice harbor a genomic DNA locus of the loxp-luciferase that is modified by the CRE protein produced from the MRNA delivered by the fusosomes to unblock the expression of the luciferase (JAXH005125). Luciferase can be detected by bioluminescent imaging in a live animal. The positive control for this example is the progeny of recipient mice mated with a mouse strain that expresses the same protein exclusively in macrophage and monocyte cells of its own genome (Cx3cr1-CRE JAXH025524). The chicks of this mating house one of each allele (loxp-luciferase, Cx3cr1- CRE).
[001491] [001491] Fusosomes are injected into the peripheral circulation by injection of the tail veins (IV, Example nº 48) in mice that harbor a genetic locus that, when triggered by the CRE protein, results in the expression of luciferase. The non-specific capture mechanism of the RES is of a phagocytic nature, releasing a proportion of the CRE protein from the fusosome in the macrophage, resulting in genomic recombination. IVIS measurements (as described in Example 62) identify where non-fusogenic controls accumulate and merge. Accumulation in the spleen, lymph nodes and liver will be indicative of nonspecific capture mediated by RES of the fusosome. IVIS is performed 24, 48 and 96 hours after the injection of the fusosome.
[001492] [001492] Mice are sacrificed and the spleen, liver and main lymphatic chains in the intestine are harvested.
[001493] [001493] Genomic DNA is isolated from these organs and subjected to quantitative polymerase chain reaction against the remainder of recombined genomic DNA. An alternative genomic locus (not directed by the CRE) is also quantified to provide a measure
[001494] [001494] In modalities, low bioluminescent signals will be observed for both the agent and the negative control in the whole animal and, specifically, in the liver and splenic sites. In the modalities, the positive control will show increased signal in the liver (over negative control and agent) and high signs in the spleen and a distribution consistent with the lymph nodes.
[001495] [001495] In one embodiment, quantification by genomic PCR of these tissues will indicate a high proportion of the recombination signals on the alternative locus in the positive control in all examined tissues, whereas for controls or agents and negatives, the level of recombination will be negligible in all fabrics.
[001496] [001496] In one embodiment, the result of this Example will indicate that the non-fusogenic controls are not retained by the RES and will be able to achieve wide distribution and exhibit high bioavailability. EXAMPLE 77: FUSOSOME LONGEVITY WITH IMMUNOSUS PRESSURE
[001497] [001497] This example describes the quantification of the immunogenicity of a fusosome composition when it is co-administered with an immunosuppressive drug.
[001498] [001498] Sometimes, therapies that stimulate an immune response can reduce therapeutic efficacy or cause toxicity to the recipient. In one embodiment, the fusosomes will be substantially non-immunogenic.
[001499] [001499] A purified composition of fusosomes as produced by any of the methods described in the previous Examples is coadministered with an immunosuppressive drug, and the immunogenic properties are tested for the longevity of the fusosome in vivo. A sufficient number of fusosomes, marked with luciferase, are injected locally into the gastrocnemius muscle of a normal mouse.
[001500] [001500] Briefly, the mice are anesthetized with isoflurane and D-luciferin is administered intraperitoneally at a dose of 375 mg per kilogram of body weight. At the time of the image, the animals are placed in a light-tight chamber and the photons emitted by the luciferase that express fusosomes transplanted into the animals are collected with integration times of 5 seconds to 5 minutes, depending on the intensity of the bio- luminescence. The same mouse is scanned repeatedly at the various time points set out above. The BLI signal is quantified in units of photons per second (total flow) and presented as log [hotons per second]. The data are analyzed by comparing the intensity and the fusosome injection with and without CT scan.
[001501] [001501] In modalities, the assay will show an increase in the longevity of the fusosome in the group co-administered by TAC in relation to the fusosome groups alone and vehicle at the end point of time. In addition to the increase in the longevity of the fusosome, in some modalities, an increase in the BLI signal of the spindle-sum plus TAC branch will be observed versus the fusosome plus vehicle or fusosomes alone at each moment. EXAMPLE 78: PREGNANT IGG AND IGM ANTIBODY MEASUREMENT REACTIVE TRIALS AGAINST FUSOSOMES
[001502] [001502] This example describes the quantification of pre-existing anti-fusosome antibody titers measured using flow cytometry.
[001503] [001503] An immunogenicity measure for fusosomes is the antibody response. Antibodies that recognize fusosomes can bind in a way that limits the activity or longevity of the fusosome. In one embodiment, some receptors for a fusosome described herein will have pre-existing antibodies that bind to and recognize fusosomes.
[001504] [001504] In this example, anti-fusosome antibody titers are tested using fusosomes produced using a cell of xenogenic origin by any of the methods described in a previous example. In this example, a virgin fusosome mouse is evaluated for the presence of anti-fusosome antibodies. Notably, the methods described here can be equally applicable to humans, mice, monkeys with protocol optimization.
[001505] [001505] The negative control is the mouse serum that has been exhausted from IgM and IgG, and the positive control is the serum derived from a mouse that received multiple injections of fusosomes generated from a cell of xenogenic origin.
[001506] [001506] To assess the presence of pre-existing antibodies that bind to fusosomes, serums of virgin mice with fusosomes are first decompressed by heating at 56ºC for 30 min and subsequently diluted by 33% in PBS containing 3% FCS and 0, 1% NaN3. Equal amounts of serum and fusosome suspensions (1x10º To 1x10º fusosomes per ml) are incubated for 30 minutes at 4ºC and washed with PBS using a calf serum pad.
[001507] [001507] IgM xenoreactive antibodies are stained by incubating the cells with goat antibodies conjugated with PE specific for the Fc portion of the mouse IgM (BD Bioscience) at 4ºC for 45 min. Notably, secondary anti-IgG1 or mouse IgG2 antibodies can also be used. The cells of all groups are washed twice with PBS containing 2% FCS and then analyzed in a FACS system (BD Biosciences). The data
[001508] [001508] In one embodiment, the negative control serum will show negligible fluorescence comparable to controls without serum or secondary. In one embodiment, the positive control will show more fluorescence than the negative control and more than controls without serum or side effects. In one embodiment, in cases where immunogenicity occurs, serum from virgin fusosome mice will show more fluorescence than the negative control. In one embodiment, in cases where immunogenicity does not occur, the serum of virgin mice with fusosomes will show similar fluorescence compared to the negative control. EXAMPLE 79: MEASUREMENT OF IGG AND ANTIBODY RESPONSES IGM AFTER SEVERAL FUSOSOMES ADMINISTRATIONS
[001509] [001509] This example describes the quantification of the humeral response of a modified fusosome after several administrations of the modified summation spindle. In one embodiment, a modified fusosome, for example, modified by a method described herein, will have a reduced humoral response (for example, reduced compared to the administration of an unmodified fusosome) after several responses (for example, more than one, for example, 2 or more), modified fusosome administrations.
[001510] [001510] An immunogenicity measure for fusosomes is antibody responses. In one embodiment, repeated injections of a fusosome can lead to the development of anti-fusosome antibodies, for example, antibodies that recognize fusosomes. In one embodiment, antibodies that recognize fusosomes can bind in a way that can limit the activity or longevity of the fusosome.
[001511] [001511] In this Example, anti-fusosome antibody titers are examined after one or more administrations of fusosomes. Fusosomes are produced by any of the previous examples. Fusosomes are generated from: unmodified mesenchymal stem cells (hereinafter referred to as MSCs), modified mesenchymal stem cells with a lentivirus-mediated HLA-G expression (hereinafter MSC-HLA-G) and stem cells mesenchymal modified with a lentivirus-mediated expression of an empty vector (hereinafter, MSC vector). Serum is collected from different cohorts: mice injected systemically and / or locally with 1, 2, 3, 5, 10 vehicle injections (Fusosome virgin group), MSC fusosomes, MSC fusosomes, MSC-HLA-G fusosomes or vectors empty MSC.
[001512] [001512] To assess the presence and abundance of anti-fusosome antibodies, mouse sera is first decompressed by heating at 56ºC for 30 min and subsequently diluted by 33% in PBS with 3% FCS and 0.1% NaN3 . Equal amounts of serums and fusosomes (1x10º to 1x10º fusosomes per ml) are incubated for 30 minutes at 4ºC and washed with PBS through a calf serum pad.
[001513] [001513] IgM antibodies reactive to the fusosome are stained by incubating the cells with goat antibodies conjugated with PE specific for the Fc portion of the mouse IgM (BD Bioscience) at 4ºC for 45 min. Notably, secondary anti-IgG1 or mouse IgG2 antibodies can also be used. The cells of all groups are washed twice with PBS containing 2% FCS and then analyzed in a FACS system (BD Biosciences). Fluorescence data are collected by logarithmic amplification and expressed as average fluorescent intensity.
[001514] [001514] In one embodiment, MSC-HLA-G fusosomes will have decreased IgM (or I9gG1 / 2) antibody titers (as measured by the fluorescence intensity in the FACS) after the injections, compared to MSC or fusosomes empty MSC vector fusosomes. EXAMPLE 80: MODIFICATION OF FU-SOSOMES ORIGIN CELLS TO EXPRESS TOLEROGENIC PROTEIN PA- RA REDUCING IMMUNOGENICITY
[001515] [001515] This example describes the quantification of immunogenicity in fusosomes derived from a modified cell source. In one embodiment, fusosomes derived from a modified cell source have reduced immunogenicity compared to fusosomes derived from an unmodified cell source.
[001516] [001516] Sometimes, therapies that stimulate an immune response can reduce therapeutic efficacy or cause toxicity to the recipient. In one embodiment, substantially non-immunogenic fusosomes are administered to a subject. In one embodiment, the immunogenicity of the cell source can be tested as a proxy for fusosome immunogenicity.
[001517] [001517] iPS cells modified using HLA-G lentivirus-mediated expression or expressing an empty vector (negative control) are analyzed for immunogenic properties as follows. A sufficient number of iPS cells, as a potential source of fusosome cells, are injected into C57 / B6 mice, subcutaneously in the rear flank, and are given an appropriate amount of time to allow the formation of teratomas.
[001518] [001518] Once the teratomas are formed, the tissues are harvested. The tissues prepared for fluorescent staining are frozen in the OCT, and those prepared for immunohistochemistry and H&E staining are fixed in 10% buffered formalin and embedded in paraffin. Tissue sections are stained with antibodies, rabbit polyclonal anti-human CD3 antibody (DAKO), anti-human CD4 mAb (RPA-TA,
[001519] [001519] Detection can be achieved using peroxidase-based visualization systems (Agilent). The data are analyzed considering the average number of infiltrated CD4 + T cells, CD8 + T cells, NK CD3 + cells present in 25, 50 or 100 tissue sections examined in a 20x field, using an optical microscope. In one embodiment, iPSCs that are not modified or iPSCs that express an empty vector will have a greater number of infiltrated CD4 + T cells, CD8 + T cells, NK CD3 + cells present in the examined fields compared to iPSCs that express HLA-G.
[001520] [001520] In one embodiment, the immunogenic properties of a fusosome will be substantially equivalent to those of the source cell. In one embodiment, fusosomes derived from HLA-G modified iPS cells will have reduced infiltration of immunological cells compared to their unmodified correspondences. EXAMPLE 81: MODIFICATION OF FUEL ORIGIN CELLS SOSOME IN KNOCKDOWN IMMUNOGENIC PROTEIN FOR REDUCING IMMUNOGENICITY
[001521] [001521] This example describes the quantification of the generation of a fusosome composition derived from a cellular source, which has been modified to reduce the expression of a molecule that is immunogenic. In one embodiment, a fusosome can be derived from a cell source, which has been modified to reduce the expression of a molecule that is immunogenic.
[001522] [001522] Therapies that stimulate an immune response can reduce therapeutic efficacy or cause toxicity to the recipient. Like this,
[001523] [001523] In this example, fusosomes are generated by any of the methods described in previous Examples. Fusosomes are generated from: unmodified mesenchymal stem cells (henceforth, MSCs, positive control), modified mesenchymal stem cells with a lentivirus-mediated expression of a class MHC-directed sShRNA | MHC (hereafter MSC-shMHC class |) and mesenchymal stem cells modified with a lentivirus-mediated expression of an undirected encoded ShRNA (hereafter negative control encoded by MSC).
[001524] [001524] Fusosomes are analyzed for expression of the MHC class | using flow cytometry. An appropriate number of fusosomes is washed and resuspended in PBS, kept on ice for 30 minutes with 1: 10-1: 4000 dilution of monoclonal antibodies conjugated to fluorescence against MHC class | (Harlan Sera-Lab, Belton, United Kingdom). Fusosomes are washed three times in PBS and resuspended in PBS. Non-specific fluorescence is determined using equal aliquots of fusosome preparation incubated with and appropriate fluorescent conjugated isotype control antibody, in equivalent dilutions. Fusosomes are analyzed on a flow cytometer (FACSort, Becton-Dickinson) and the data are analyzed with flow analysis software (Becton-Dickinson).
[001525] [001525] The mean fluorescence data of the fusosomes derived from MSCs, MSCs-shMHC class |, encoded by MSC, are compared. In one embodiment, fusosomes derived from MSCs-ShMHC class | will have lesser expression of MHC class | compared to MSCs and encoded by MSC.
[001526] [001526] This example describes the quantification of phagocytosis evasion by modified fusosomes. In one embodiment, modified fusosomes prevent macrophage phagocytosis.
[001527] [001527] Cells engage phagocytosis, swallowing particles, allowing the sequestration and destruction of foreign invaders, such as bacteria or dead cells. In some embodiments, phagocytosis of fusosomes by macrophages would reduce its activity.
[001528] [001528] Fusosomes are generated by any of the methods described in the previous Examples. Fusosomes are created from: CSFE-labeled mammalian cells that do not have CD47 (hereinafter, NMC, positive control), CSFE-labeled cells that are designed to express CD47 using the lentivirus-mediated expression of a CD47 cDNA (hereinafter NMC-CDA47) and CSFE-labeled cells manipulated using the lentivirus-mediated expression of an empty vector control (hereinafter, empty NMC-vector, negative control).
[001529] [001529] The reduction in macrophage-mediated immune clearance is determined with a phagocytosis assay according to the following protocol. Macrophages are bathed immediately after collection in confocal plates with a glass bottom. The macrophages are incubated in DMEM + 10% FBS + 1% P / S for 1 h to bind. An appropriate number of fusosomes derived from the empty vector NMC, NMC-CD47, NMC are added to the macrophages as indicated in the protocol and are incubated for 2 hours, tools.thermofisher.com/ content / sfs / manuals / mp06694 .pdf.
[001530] [001530] After 2 h, the plate is washed gently and the intracellular fluorescence is examined. The intracellular fluorescence emitted by swallowed particles is visualized by confocal microscopy at 488 excitations
[001531] [001531] In one embodiment, the phagocytic index will be reduced when macrophages are incubated with NMC-CD47-derived fusosomes, compared to those derived from NMC or empty NMC vector. EXAMPLE 83: MODIFICATION OF FUEL ORIGIN CELLS SOSOMES FOR REDUCED CYTOOTOXICITY MEDIATED BY PBMC CELL LYSIS
[001532] [001532] This example described the generation of fusosomes derived from cells modified to have reduced cytotoxicity due to cell lysis by PBMCs.
[001533] [001533] In one embodiment, cell lysis mediated by cytotoxicity of cells of origin or fusosomes by PBMCs is a measure of immunogenicity for fusosomes, as lysis will reduce, for example, inhibit or interrupt the activity of a fusosome.
[001534] [001534] In this example, fusosomes are generated by any of the methods described in a previous example. Fusosomes are created from: unmodified mesenchymal stem cells (MSCs below, positive control), modified mesenchymal stem cells with lentiviral-mediated HLA-G expression (hereinafter MSC-HLA-G) and mesenchymal stem cells modified with a lentiviral expression mediated by an empty vector (hereinafter empty MSC vector, negative control).
[001535] [001535] The PMBC-mediated lysis of a fusosome is determined by europium release assays, as described in Bouma, et al. Hum. Immunol. 35 (2): 85 to 92; 1992 and van Besouw et al. Trans-
[001536] [001536] On day 7, cytotoxicity-mediated lysis assays are performed by incubating ºEU-labeled fusosomes with effector cells in a 96-well titration plate for 1, 2, 3.4, 5,6,8, 10, 15, 20, 24, 48 hours after plating in effector / target ratios ranging from 1000: 1 to 1: 1 and 1: 1.25 to 1: 1000. After incubation, the plates are centrifuged and a sample of the supernatant is transferred to 96-well plates with low background fluorescence (fluorimunoplates, Nunc, Roskilde, Denmark).
[001537] [001537] Subsequently, the enhancement solution (PerkinElmer, Groningen, Netherlands) is added to each well. The released europium is measured on a time-resolved fluorometer (multi-meter Victor 1420, LKB-Wallac, Finland). Fluorescence is expressed in counts per second (CPS). Maximum percent release of europium by a target fusosome is determined by incubating an appropriate number (1x 10º -1x 10º) of fusosomes with 1% Triton (Sigma-Aldrich) for an appropriate amount of time. The spontaneous release of europium by target fusosomes is measured by incubation of marked target fusosomes without effector cells. The leakage percentage is then calculated as: (spontaneous release / maximum release) x100%. Finally, the percentage of lysis mediated by cytotoxicity is calculated as% of lysis = [(measured lysis - spontaneous lysis - spontaneous release) / (maximum release - spontaneous release)] x100%. The data are analyzed by observing the percentage of lysis as a function of different target effector proportions.
[001538] [001538] In one embodiment, fusosomes generated from MSC-HLA-G cells will have a decreased percentage of lysis by the target cells, at specific times compared to MSCs or fusosomes generated by MSC coding. EXAMPLE 84: MODIFICATION OF SPINDLE ORIGIN CELLS SUMS FOR LISE NK LISED ACTIVITY
[001539] [001539] This example describes the generation of a fusosome composition derived from a cell source, which has been modified to decrease cytotoxicity-mediated cell lysis by NK cells. In one embodiment, cell lysis mediated by cytotoxicity of cells of origin or fusosomes by NK cells is a measure of immunogenicity for fusosomes.
[001540] [001540] In this example, fusosomes are generated by any of the methods described in a previous example. Fusosomes are created from: unmodified mesenchymal stem cells (MSCs below, positive control), modified mesenchymal stem cells with lentiviral-mediated HLA-G expression (hereinafter MSC-HLA-G) and mesenchymal stem cells modified with a lentiviral expression mediated by an empty vector (hereinafter empty MSC vector, negative control).
[001541] [001541] NK cell-mediated lysis of a fusosome is determined by europium release assays, as described in Bouma, et al. Hum. Immunol. 35 (2): 85 to 92; 1992 and van Besouw et al. Transplant 70 (1): 136 to 143; 2000. NK cells (hereinafter, effector cells) are isolated from an appropriate donor according to the methods of Crop et al. Cell transplantation (20): 1,547 to 1,559; 2011, and stimulated with PMBCs irradiated with an allogeneic range and 200 IU / ml IL-2 (proleucine, Chiron BV Amsterdam, Netherlands) in a 96-well round bottom titration plate for 7 days at 37ºC. Fusosomes are labeled with europium-diethylenetriaminopentaacetate
[001542] [001542] On day 7, cytotoxicity-mediated lysis assays are performed by incubating Euºº-labeled fusosomes with effector cells in a 96-well titration plate for 1, 2, 3.4, 5,6,8, 10, 15, 20, 24, 48 hours after plating in effector / target ratios ranging from 1000: 1 to 1: 1 and 1: 1.25 to 1: 1000. After incubation, the plates are centrifuged and a sample of the supernatant is transferred to 96-well plates with low background fluorescence (fluorimunoplates, Nunc, Roskilde, Denmark).
[001543] [001543] Subsequently, the enhancement solution (PerkinElmer, Groningen, Netherlands) is added to each well. The released europium is measured on a time-resolved fluorometer (multi-meter Victor 1420, LKB-Wallac, Finland). Fluorescence is expressed in counts per second (CPS). Maximum percent release of europium by a target fusosome is determined by incubating an appropriate number (1x 10 -1x 10º) of fusosomes with 1% Triton (Sigma-Aldrich) for an appropriate amount of time. The spontaneous release of europium by target fusosomes is measured by incubation of marked target fusosomes without effector cells. The leakage percentage is then calculated as: (spontaneous release / maximum release) x100%. Finally, the percentage of lysis mediated by cytotoxicity is calculated as% of lysis = [(measured lysis - spontaneous lysis - spontaneous release) / (maximum release - spontaneous release)] x100%. The data are analyzed by observing the percentage of lysis as a function of different target effector proportions.
[001544] [001544] In one embodiment, fusosomes generated from MSC-HLA-G cells will have a decreased percentage of lysis at appropriate time points compared to MSCs or fusosomes generated by MSC-encoded coding.
[001545] [001545] This example describes the generation of a fusosome composition derived from a cell source, which has been modified to decrease cell lysis mediated by cytotoxicity by CD8 + T cells. In one embodiment, cell lysis mediated by cytotoxicity of cells of origin or fusosomes by CD8 + T cells is a measure of immunogenicity for fusosomes.
[001546] [001546] In this example, fusosomes are generated by any of the methods described in a previous example. Fusosomes are created from: unmodified mesenchymal stem cells (MSCs below, positive control), modified mesenchymal stem cells with lentiviral-mediated HLA-G expression (hence, MSC-HLA-G ) and mesenchymal stem cells modified with a lentiviral expression mediated by an empty vector (hereinafter, empty MSC vector, negative control).
[001547] [001547] The lysis mediated by CD8 + T cells of a fusosome is determined by europium release assays, as described in Bouma, et al. Hum. Immunol. 35 (2): 85 to 92; 1992 and van Be- souw et al. Transplant 70 (1): 136 to 143; 2000. CD8 + T cells (hereinafter, effector cells) are isolated from an appropriate donor according to the methods of Crop et al. Cell transplantation (20): 1547-1559; 2011, and stimulated with PMBCs irradiated with allogeneic range and 200 IU / ml IL-2 (proleucine, Chiron BV Amsterdam, Netherlands) in a 96-well round-bottom titration plate for 7 days at 37ºC. Fusosomes are labeled with europium-diethylenetriaminopentaacetate (DTPA) (sigma, St. Louis, MO, USA).
[001548] [001548] On day 7, cytotoxicity-mediated lysis assays are performed by incubating Euº-labeled fusosomes with effector cells in a 96-well titration plate for 1, 2, 3.4, 5,6,8, 10, 15, 20, 24, 48 hours after plating at effector / target ratios ranging from 1000: 1 to 1: 1 and 1: 1.25 to 1: 1000. After incubation, the plates are centrifuged and 20 µl of the supernatant is transferred to 96-well titration plates with low background fluorescence (fluoroimmunoplates, Nunc, Roskilde, Denmark).
[001549] [001549] Subsequently, the enhancement solution (PerkinElmer, Groningen, Netherlands) is added to each well. The released europium is measured on a time-resolved fluorometer (multi-meter Victor 1420, LKB-Wallac, Finland). Fluorescence is expressed in counts per second (CPS). Maximum percent release of europium by a target fusosome is determined by incubating an appropriate number (1x 10º -1x 108º) of fusosomes with 1% Triton (Sigma-Aldrich) for an appropriate amount of time. The spontaneous release of europium by target fusosomes is measured by incubation of marked target fusosomes without effector cells. The leakage percentage is then calculated as: (spontaneous release / maximum release) x100%. Finally, the percentage of lysis mediated by cytotoxicity is calculated as% of lysis = [(measured lysis - spontaneous lysis - spontaneous release) / (maximum release - spontaneous release)] x100%. The data are analyzed by observing the percentage of lysis as a function of different target effector proportions.
[001550] [001550] In one embodiment, fusosomes generated from MSC-HLA-G cells will have a decreased percentage of lysis at appropriate times, compared to MSCs or generated fusosomes encoded by MSC. EXAMPLE 86: MODIFICATION OF SPINDLE ORIGIN CELLS SUMMARY TO REDUCE T-CELL ACTIVATION
[001551] [001551] This example describes the generation of modified fusosomes that will have reduced T cell activation and proliferation, assessed by a mixed lymphocyte reaction (MLR).
[001552] [001552] T cell proliferation and activation are measures of immunogenicity for fusosomes. Stimulation of T cell proliferation in an MLR reaction by a fusosome composition could suggest stimulation of T cell proliferation in vivo.
[001553] [001553] In one embodiment, fusosomes generated from cells of modified origin have reduced T cell activation and proliferation, as assessed by a mixed lymphocyte reaction (MLR). In one embodiment, fusosomes generated from cells of modified origin do not generate an immune response in vivo, thus maintaining the effectiveness of the fusosome composition.
[001554] [001554] In this example, fusosomes are generated by any of the methods described in a previous example. Fusosomes are generated from: unmodified mesenchymal stem cells (MSCs below, positive control), modified mesenchymal stem cells with IL-10 mediated lentiviral expression (hereinafter MSC-IL-10) and cells - modified mesenchymal stem with a slow viral expression mediated by an empty vector (hereinafter, empty MSC vector, negative control).
[001555] [001555] BALB / c and C57BL / 6 splenocytes are used as stimulating or responding cells. Notably, the source of these cells can be exchanged with commonly used human-derived stimulator / responder cells. In addition, any purified mammalian allogeneic CD4 + T cell population, CD8 + or CD4- / CD8- T cell population can be used as a responder population.
[001556] [001556] Mouse splenocytes are isolated by mechanical dissociation using fully matte slides followed by lysis of red blood cells with lysing buffer (Sigma-Aldrich, St-Louis, MO). Before the experiment, the stimulator cells are irradiated with 20 Gy of y-ray to prevent them from reacting against the responder cells. A co-culture is then performed by adding equal numbers of stimulator and responder cells (or alternative concentrations while maintaining a 1: 1 ratio) to a 96-well round bottom titration plate in complete DMEM-10 medium. An appropriate number of fusosomes (in various concentrations over a range of 1x10º -1x108) is added to the co-culture at different time intervals, t = 0, 6, 12, 24, 36, 48h.
[001557] [001557] Proliferation is assessed by adding 1 µCi of [H] - thymidine (Amersham, Buckinghamshire, United Kingdom) to allow incorporation. [ H] - thymidine is added to the MLR at t = 2, 6, 12, 24, 36, 48, 72 h, and the cells are harvested on fiberglass filters using a 96-well cell collector (lInoteck, Bertold, Japan) after 2, 6, 12, 18, 24, 36 and 48 hours of extended culture. All T cell proliferation experiments are performed in triplicate. [ºH] - Thymidine is measured using a Microbeta ILuminescence counter (Perkin Elmer, Wellesley, MA). The results can be represented as counts per minute (cpm).
[001558] [001558] In one embodiment, MSC-IL10 fusosomes will show a decrease in T cell proliferation compared to the MSC-Empty vector or the unmodified MSC fusosome controls. EXAMPLE 87: MEASUREMENT OF THE SEGMENTATION POTENTIAL IN A SUBJECT
[001559] [001559] This example assesses the ability of a fusosome to reach a specific location in the body. In one embodiment, a spindle can target a specific location on the body. Targeting is a way of restricting the activity of a therapeutic to one or more relevant therapeutic sites.
[001560] [001560] C57BL / 6J mice at eight weeks of age
[001561] [001561] Five minutes before euthanasia, the mice receive an IP injection of bioluminescent substrate (Perkin Elmer) at a dose of 150 mg / kg, in order to visualize luciferase. The bioluminescent imaging system is calibrated to compensate for all device configurations. The mice are then sacrificed and the liver, lungs, heart, spleen, pancreas, GI and kidney are collected. The imaging system (Perkin Elmer) is used to obtain bioluminescence images of these organs ex vivo. The bioluminescent signal is measured using Radiance Photons, with full flow used as a measured value. The region of interest (ROI) is generated around the organ ex vivo, in order to provide a value in photons / second. The proportion of photons / second between target organs (for example, liver) and non-target organs (for example, the sum of photons / second of lungs, heart, spleen, pancreas, GI and kidney) is calculated as a measure targeting to the liver.
[001562] [001562] In one embodiment, in fusosomes and cells, the proportion of photons / second between the liver and the other organs will be greater than 1, which would indicate that fusosomes target the liver. In one embodiment, negative control animals will exhibit much lower photons / second in all organs.
[001563] [001563] This example describes the quantification of the delivery of fososomes comprising an exogenous agent in a subject. Fososomes are prepared from cells that express Gaussia luciferase or cells that do not express luciferase (negative control) by any of the methods described in the previous examples.
[001564] [001564] Positive control cells or fusosomes are injected intravenously into mice. Fusosomes or cells are delivered in 5 to 8 seconds using a 26-gauge insulin syringe needle. In vivo bioluminescent imaging is performed on mice 1, 2 or 3 days after injection using an in vivo imaging system ( Xenogen Corporation, Alameda, CA).
[001565] [001565] Immediately before use, coelenterazine, a luciferin or light-emitting molecule (5 mg / ml) is prepared in acidified methanol and injected immediately into the vein of the mice's tail. The mice are under continuous anesthesia in a heated stage using the Gas Anesthesia System XGl1-8.
[001566] [001566] The bioluminescent image is obtained by acquiring photon counts for more than 5 minutes immediately after the intravenous injection of coelenterazine in the caudal vein (4 pg / g of body weight). The acquired data are analyzed using the software (Xenogen) with the overlay on the light visualization image. Regions of interest (ROI) are created using an automatic signal intensity contouring tool and standardized with background subtraction of the same animal. A sequential data acquisition using three filters at 580, 600 and 620 nm wavelengths with an exposure time of 3 to 10 min is performed to locate bioluminescent sources of light within a mouse.
[001567] [001567] In addition, at each moment, urine samples are collected by abdominal palpation.
[001568] [001568] Blood samples (50 ul) are obtained from the tail vein of each mouse into heparinized tubes or EDTA. For plasma isolation, blood samples are centrifuged for 25 minutes at 1.3 x ga4ºC.
[001569] [001569] Next, 5 µl of blood, plasma or urine sample is used to perform a Gaussia luciferase activity assay after mixing the samples with 50 µM Gaussia luciferase substrate (Nanolight, Pinetop, AZ).
[001570] [001570] In one embodiment, the negative control samples will be negative for luciferase and the positive control samples will be from cells administered by animals. In one embodiment, samples from animals administered with fusosomes that express Gaussia luciferase will be positive for luciferase in each sample.
[001571] [001571] See, for example, EIl-Amouri SS et al., Molecular biotechnology 53 (1): 63-73, 2013. EXAMPLE 89: ACTIVE TRANSPORT THROUGH A BILAYER LIPID OF A FUSOSOME
[001572] [001572] This example describes the quantification of the level of 2-NBDG (2- (N- (7-nitrobenz-2-0xa-1,3-diazol-4-yl) Amino) -2-deoxyglucose), - glycol analog fluorescent cose that can be used to monitor glucose uptake in living cells and thus active transport through the lipid bilayer. In one embodiment, this assay can be used to measure the level of glucose uptake and active transport through the lipid bilayer of the fusosome.
[001573] [001573] A fusosome composition as produced by any of the methods described in the previous Examples. A sufficient number of fusosomes are then incubated in DMEM containing any glucose, 20% Bovine Fetal Serum and 1x Penicillin.
[001574] [001574] Fusosomes are washed three times with 1xPBS and resuspended in an appropriate buffer and transferred to a 96-well imaging plate. The fluorescence of 2-NBDG is then measured on a fluorimeter using a GFP light cube (excitation filter 469/35 and an emission filter 525/39) to quantify the amount of 2-NBDG that has been transported across the fusosome membrane and accumulated in the fusosome within 1 hour of loading.
[001575] [001575] In one embodiment, 2-NBDG fluorescence will be greater in fusosomes with 2-NBDG treatment, compared to the negative control (DMSO). Fluorescence measured with a 525/39 emission filter will be relative to the number of 2-NBDG molecules present. EXAMPLE 90: DELIVERY OF FUSOSOMES BY NON-BETWEEN CYTIC
[001576] [001576] This example describes the quantification of the delivery of the Cre fosome to a recipient cell by a non-endocytic pathway.
[001577] [001577] In one embodiment, fusosomes deliver agents via a fusosome-mediated non-endocytic pathway. Without wishing to be bound by theory, the delivery of an agent, for example, Cre, which is transported inside the lumen of the fusosomes, directly to the cytosol of the recipient cells, without the need for endocytosis-mediated uptake of the fusosomes, will occur through of a fusosome-mediated non-endocytic pathway.
[001578] [001578] In this example, the fusosome comprises a HEK293T cell that expresses the H and F proteins of the Sendai virus in its plasma membrane (Tanaka et al., 2015, Gene Therapy, 22 (October 2014), 1-8. Http://doi.org/10.1038/gt.2014.123). In addition, the fusosome expresses the fluorescent protein mTagBFP2 and recombinase Cre. The target cell is an RPMI8226 cell that stably expresses the "LoxP-GFP-stop-LoxP-RFP" cassette under a CMV promoter, which after Cre recombination alternates from GFP to RFP expression, indicating fusion and Cre , as a marker, delivery.
[001579] [001579] Fusosomes produced by the methods described here are tested for the delivery of Cre by a non-endocytic route as follows. The recipient cells are plated on a 96-well plate with a light background. Then, 24 hours after the plating of the recipient cells, fusosomes that express the Cre recombinase Cre protein and have the specific fusogen protein are applied to the recipient cells in DMEM media. To determine the level of Cre delivery by a non-endocytic route, a parallel group of receptor cells that receive fusosomes is treated with an endosomal acidification inhibitor, chloroquine (30 pg / ml). The dose of fusosomes is correlated with the number of recipient cells plated in the well. After applying the fusosomes, the cell plate is centrifuged at 400 g for 5 minutes to help initiate contact between the fusosomes and the recipient cells. The cells are then incubated for 16 hours and the delivery of the agent, Cre, is evaluated by imaging.
[001580] [001580] The cells are visualized to positively identify positive cells for RFP versus positive cells for GFP in the field or well. In this example, cell plates are photographed using an automated fluorescence microscope. The total cell population in a given well is determined by first staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by interleaving in DNA and is therefore used to identify individual cells. After staining, Hoechst media is replaced with regular DMEM media.
[001581] [001581] Hoechst is photographed using the LED filter hub and DAP! 405 nm. The GFP is created using the 465 nm LED and GFP filter cube, while the RFP is created using the 523 nm LED and RFP filter cube. The images of the different groups of cells are obtained by first establishing the intensity of the LED and the integration times in a positive control well; that is, recipient cells treated with adenovirus that encode Cre recombinase instead of fusosomes.
[001582] [001582] The acquisition settings are defined so that the RFP and GFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest are then imaged using the established settings.
[001583] [001583] The analysis of positive wells for GFP and RFP is performed with the software provided with the fluorescence microscope or other software (Rasband, WS, ImageuJ, US National Institutes of Health, Bethesda, Maryland, USA, 1997-2007) . The images are pre-processed using a ball-bottom subtraction algorithm with a width of 60 µm. The total cell mask is defined in Hoechst positive cells. Cells with Hoechst intensity significantly above background intensities are used to define a threshold, and areas too small or large to be Hoechst positive cells are excluded.
[001584] [001584] Within the total cell mask, positive cells for GFP and RFP are identified by again defining a threshold for cells significantly above the background and extending Hoichst masks (nuclei) to the entire cell area to include all fluorescence cell of GFP and RFP.
[001585] [001585] The number of positive RFP cells identified in the control wells containing recipient cells is used to subtract from the number of positive RFP cells in the wells containing fossa (to subtract for non-specific Loxp recombination). The number of positive RFP cells (recipient cells that received Cre) is then divided by the sum of positive GFP cells (recipient cells that did not receive Cre) and positive RFP cells to quantify the fraction of Cre fusosome delivered to the recipient. cell population. The level is normalized to the determined dose of fusosomes applied to the recipient cells. To calculate the value of Cre fusosome delivered by a non-endocytic route, the level of fusosome delivery in the presence of chloroquine (FusL + CQ), as well as the level of fusosome delivery in the absence of chloroquine (FusL-CQ) is determined ). To determine the normalized value of the Cre fusosso delivered by a non-endocytic route, the following equation is used: [(FusL-CQ) - (FusL-CQ) - (FusL + CQ)] / (FusL-CQ).
[001586] [001586] In one embodiment, the average level of Cre fusosome delivered via a non-endocytic pathway for a given fusosome will be in the range of 0.1 to 0.95, or at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more than the chloroquine-treated recipient cells. EXAMPLE 91: DELIVERY OF FUSOSOMES THROUGH THE DOCUMENT
[001587] [001587] This example describes the fusosome delivery of Cre to a recipient cell via an endocytic pathway.
[001588] [001588] In one embodiment, fusosomes deliver agents via a fusosome-mediated endocytic pathway. Without wishing to be limited by theory, the delivery of an agent, for example, a cargo carried in the lumen of the fusosomes, to the receiving cells.
[001589] [001589] In this example, the fusosome comprises microvesicles that were produced by extruding a cell expressing a fusogen HEK293T protein in its plasma membrane through a 2 um filter (Lin et al., 2016, Biomedical Microdevices, 18 (3). doi.org/10.1007/s10544-016-0066-y) (Riedel, Kondor-Koch and Garoff, 1984, The EMBO Journal, 3 (7), 1477-1483). Retrieved from www.ncbi.nIm.nih.gov/pubmed/6086326. In addition, the fusosome expresses the fluorescent protein mTagBFP2 and the recombinase Cre. The target cell is a PC3 cell that stably expresses the "LoxP-GFP-stop-LoxP-RFP" cassette under a CMV promoter, which after the Cre-combination alternates from GFP to RFP expression, indican - the merger and Cre, as a marker, delivery.
[001590] [001590] Fusosomes produced by the methods described here are tested for the delivery of Cre by an endocytic route as follows. The recipient cells are plated on a multi-well cell culture plate compatible with the imaging system to be used (in this example, the cells are plated on a black 96-well plate with a transparent background). Then, 24 hours after the plating of the recipient cells, the fusosomes that express the Cre recombinase Cre protein and have the specific fu- sogen protein are applied to the recipient cells in DMEM media. To determine the level of Cre delivery through an endocytic pathway, a parallel group of receptor cells that receive fososomes is treated with an inhibitor of endosomal acidification, chloroquine (30 pg / ml). The dose of fusosomes is correlated with the number of recipient cells plated in the well. After applying the fusosomes, the cell plate is centrifuged at 400 g for 5 minutes to help initiate contact between the fusosomes and the receiving cells.
[001591] [001591] The cells are visualized to positively identify positive cells for RFP versus positive cells for GFP in the field or well. In this example, cell plates are photographed using an automated fluorescent microscope. The total cell population in a given well is determined by first staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by interleaving in DNA and is therefore used to identify individual cells. After staining, Hoechst media is replaced with regular DMEM media.
[001592] [001592] Hoechst is photographed using the LED filter hub and DAP! 405 nm. The GFP is created using the 465 nm LED and GFP filter cube, while the RFP is created using the 523 nm LED and RFP filter cube. The images of the different groups of cells are obtained by first establishing the intensity of the LED and the integration times in a positive control well; that is, recipient cells treated with adenovirus that encode Cre recombinase instead of fusosomes.
[001593] [001593] The acquisition settings are defined so that the RFP and GFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest are then imaged using the established settings.
[001594] [001594] The analysis of positive wells for GFP and RFP is performed with the software provided with the fluorescent microscope or other software (Rasband, WS, ImageyJ, US National Institutes of Health, Bethesda, Maryland, USA, 1997-2007 ). The images are pre-processed using a ball-bottom subtraction algorithm with a width of 60 µm. The total cell mask is defined in Hoechst positive cells. Cells with Hoechst intensity significantly
[001595] [001595] Within the total cell mask, GFP and RFP positive cells are identified by again limiting cells significantly above the bottom and extending Hoechst masks (nuclei) to the entire cell area to include all cell fluorescence from GFP and RFP.
[001596] [001596] The number of positive RFP cells identified in the control wells containing recipient cells is used to subtract from the number of positive RFP cells in the wells containing fossa (to subtract for non-specific Loxp recombination). The number of positive RFP cells (recipient cells that received Cre) is then divided by the sum of the positive cells for GFP (recipient cells that did not receive Cre) and positive cells for RFP to quantify the fraction of Cre fusosome delivered to the population. receptor cells. The level is normalized to the determined dose of fusosomes applied to the recipient cells. To calculate the value of Cre fusosome delivered endocytically, the level of Cre fusosome delivery in the presence of chloroquine (FusL + CQ) is determined, as well as the level of Cre fusosome delivery in the absence of chloroquine (FusL-CQ ). To determine the normalized value of the Cre fusosso delivered via an endocytic route, the following equation is used: (FusL + CQ) / (FusL-CQ).
[001597] [001597] In one embodiment, the average level of Cre fusosome delivered via an endocytic pathway for a given fusosome will be in the range of 0.01 to 0.6 or at least 1%, 2%, 3%, 4% , 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or higher than the chloroquine-treated recipient cells.
[001598] [001598] This example describes the fusosome delivery of Cre to a recipient cell via a dinamine-mediated pathway. A sump spindle comprising a microvesicle can be produced as described in the previous example. Fusosomes are tested for Cre delivery via a dinamine-mediated pathway, according to the previous example, except that a group of receptor cells receiving fusosomes is treated with a dinamine inhibitor, Dynasore (120 UM). To calculate the Cre fusosome value delivered via a dinamine-mediated pathway, the level of fusosome delivery in the presence of Dynasore (FusL + DS) is determined, as well as the level of fusosome delivery in the absence of Dynasore (FusL - DS). The normalized value of Cre fusosso delivered can be calculated as described in the previous example.
[001599] [001599] This example also describes the delivery of Cre to a recipient cell via macropinocytosis. A fusosome comprising a microvesicle can be produced as described in the previous example. Fusosomes are assayed for the delivery of Cre through maculinokinocytosis according to the previous example, except that a group of recipient cells receiving fusosomes is treated with a macropinocytosis inhibitor, 5- (N-ethyl-N-isopropyl ) amyloride (EIPA) (25 µM). To calculate the value of Cre fusosome delivered via macropinocytosis, the level of Cre fusosome delivery in the presence of EIPA (FusL + EPIA) is determined, as well as the level of Creus fusosome delivery in the absence of EPIA (FusL-EIPA). The normalized value of Cre fusosso delivered can be calculated as described in the previous example.
[001600] [001600] This example also describes the fusosome delivery of Cre to a recipient cell via an actin-mediated pathway.
[001601] [001601] This example describes the fusion of the fusosome with a cell in vitro. In one embodiment, fusosome fusion with an in vitro cell can result in the delivery of fusosomal mitochondrial charge to the recipient cell.
[001602] [001602] A fusosome produced by the methods described by the methods described here was tested for its ability to deliver its mitochondria to the recipient cell as follows.
[001603] [001603] In this particular example, the fusosome was a HEK293T cell expressing a fusogenic protein in its membrane, as well as the DsSRED protein (myth-DsRED) directed to mitochondria to mark mitochondria. The recipient cells were plated on a multi-well cell culture plate compatible with the imaging system to be used (in this example, the cells were plated on a glass bottom imaging plate). The cytosolic GFP receptor cells expressed stably.
[001604] [001604] Then, 24 hours after the plating of the recipient cells, the fusosome expressing myth-DsRED and having the specific fusogenic protein was applied to the recipient cells in medium
[001605] [001605] In this example, the cells were photographed in a Zeiss LSM 710 confocal microscope with a 63x oil immersion objective, while kept at 37ºC and 5% CO>. The GFP was subjected to 488 nm laser excitation and the emission was recorded using a 495-530 nm bandpass filter. The DsRED was subjected to laser excitation of 543 nm and the emission was recorded through a bandpass filter from 560 to 610 nm. The cells were scanned to positively identify cells positive for cytosolic GFP fluorescence and myth-DsRED fluorescence.
[001606] [001606] The presence of cytosolic GFP and myth-DsRED mitochondria was found in the same cell, indicating that the cell was subjected to VSVG-mediated fusion and therefore the mitochondria were delivered from the fusosome to the recipient cell. EXAMPLE 94: IN VITRO DELIVERY OF DNA
[001607] [001607] This example describes the delivery of DNA using spindles to cells in vitro. This example quantifies the ability of fusosomes to deliver DNA using a plasmid encoding an exogenous gene, GFP, a substitute therapeutic load.
[001608] [001608] A fusosome composition, resulting from vesicles derived from cells or cytobiologicals derived from cells, produced
[001609] [001609] See, for example, Chen X, et al, Genes Dis. 2015 Mar; 2 (1): 96- 105.DO!: 10.1016 / j.gendis.2014.12.001.
[001610] [001610] As a negative control, fusosomes are nucleofected with a plasmid with a sequence encoding beta-actin.
[001611] [001611] A sufficient number of fusosomes are then incubated at 37ºC and 5% CO, together with a recipient NIH / S3T3 fibroblast cell line that has a loxP-STOP-loxP-tdTomato reporter for a period of 48 hours in DMEM containing 20% fetal bovine serum and 1x penicillin / streptomycin. After the 48 hour incubation, positive tdTomato cells are then isolated via FACS, using a FACS cytometer (Becton Dickinson, San Jose, CA, USA) with 561nm laser excitation and emission is collected at 590 +/- 20nm. The total DNA is then isolated using a DNA extraction solution (Epicenter) and PCR is performed using GFP specific primers (see Table 12), which amplify a 600 bp fragment. A 600 bp fragment present in a gel after gel electrophoresis substantiates the presence of DNA delivery to the receiving cell. TABLE 12. GFP INITIATOR SEQUENCES THAT AMPLIFY A FRAGMENT OF 500 PB
[001612] [001612] In one embodiment, nucleic acid charge delivery with fusosomes in vitro is greater in fusosomes with plasmid GFP compared to the negative control. Negligible GFP fluorescence is detected in the negative control. EXAMPLE 95: IN VIVO DELIVERY OF DNA
[001613] [001613] This example describes the delivery of DNA to cells in vivo via fusosomes. The delivery of DNA to cells in vivo results in the expression of proteins within the recipient cell.
[001614] [001614] The delivery of fusosome DNA in vivo will demonstrate the delivery of expression of DNA and protein in recipient cells within an organism (mouse).
[001615] [001615] Fusosomes expressing a liver-directed fusogen are prepared as described here. After the production of the fossa, it is additionally nucleofected with a plasmid having a sequence encoding Cre recombinase.
[001616] [001616] Fusosomes are prepared for in vivo delivery. Fusosome suspensions are subjected to centrifugation. Fusosome granules are resuspended in sterile phosphate-buffered saline for injection.
[001617] [001617] Fusosomes are found to contain DNA using a nucleic acid detection method, for example, PCR.
[001618] [001618] The recipient mice harbor a genomic DNA locus of the loxp-luciferase that is modified by the CRE protein made from the DNA delivered by the fusosomes to unblock the luciferase expression (JAXH005125). The positive control for this example is the progeny of recipient mice mated with a mouse strain that expresses the same protein exclusively in the liver from its own genome (albumin-CRE JAXH003574). The chicks of this mating house one of each allele (loxp-luciferase, albumin-CRE). Negative controls are
[001619] [001619] Fusosomes are delivered to mice by intravenous administration of tail veins (IV). The mice are placed in a commercially available mouse limiter (Harvard Apparatus). Before the restriction, the animals are heated by placing their cage in a circulating water bath. Once inside the limiter, animals can get used to it. A | V catheter consisting of a 30G needle tip, a 7.62 cm (3 inch) long PE-10 tube and a 28G needle is prepared and washed with heparinized saline. The tail is cleaned with a 70% alcohol preparation pad. Then, the catheter needle is held with forceps and slowly inserted into the lateral vein of the tail until the blood becomes visible in the tube. Is the fusosome solution (- 500K to 5M fusosomes) aspirated into a 1 cm tuberculin syringe and connected to an infusion pump. The fusosome solution is supplied at a rate of 20 ul per minute, for 30 seconds to 5 minutes, depending on the dose. After the infusion is complete, the catheter is removed and pressure is applied to the injection site until any bleeding stops. The mice are returned to their cages and left to recover.
[001620] [001620] After the fusion, the DNA will be transcribed and translated into the CRE protein, which will be translocated to the nucleus to perform the recombination, resulting in the constitutive expression of luciferase. The intraperitoneal administration of D-luciferin (Perkin Elmer, 150 mg / kg) allows the detection of luciferase expression through the production of bioluminescence. The animal is placed in a bioluminescent imaging chamber in vivo (Perkin Elmer), which houses a cone anesthetic (isoflurane) to prevent the animal from moving. Photon collection is performed between 8 and 20 minutes after injection to observe the maximum in bioluminescence due to the pharmacokinetic clearance of D-luciferin. A specific region of the liver is created in the software and at the defined exposure time of the collection so that the counting rates are above 600 (in this region) to produce interpretable radiation measurements (photons / s / cm2 / steradians). The maximum value of the bioluminescent radiation is recorded as the image of the bioluminescence distribution. Liver tissue is monitored specifically for measurements of brightness above the bottom (untreated animals) and those of negative controls. Measurements are performed 24 hours after the injection to observe luciferase activity. The mice are sacrificed and the livers are harvested.
[001621] [001621] The newly harvested tissue is subjected to fixation and incorporation by immersion in 4% paraformaldehyde / 0.1 M sodium phosphate buffer pH 7.4 at 4ºC for 1 to 3 hours. The tissue is then immersed in sterile 15% sucrose / 1xPBS (3 hours overnight) at 4ºC. The fabric is then incorporated into the O.C.T. (Baxter No. M7148-4). The fabric is oriented on the block properly for the section (cross section). The tissue is then frozen in liquid nitrogen using the following method: place the lower third of the block in liquid nitrogen, let it freeze until the entire center of the PTU is frozen and allow the freezing to end on dry ice. The blocks are sectioned by cryostat in sections of 5 to 7 microns placed on slides and refrozen for staining.
[001622] [001622] In situ hybridization is performed (using standard methods) on tissue sections using nucleic acid probes labeled with digoxygenin (for detection of CRE DNA and luciferase mRNA), marked by fluorescent anti-digoxygenin antibodies and observed by confocal microscopy.
[001623] [001623] In modalities, positive control animals (recombined
[001624] [001624] In modalities, the detection of nucleic acid in tissue sections in animals injected with agent will reveal the detection of CRE recombinase MRNA and luciferase compared to negative controls and untreated animals in tissue cells, while positive controls will show levels of luciferase MRNA and CRE recombinase DNA throughout the tissue.
[001625] [001625] Evidence of DNA delivery by fusosomes will be detected by detection based on in situ hybridization of DNA and its colocalization in the animal's receptor tissue. The activity of the protein expressed from the DNA will be detected by a bioluminescent image. In modalities, fusosomes deliver DNA that results in the production and activity of proteins. EXAMPLE 96: IN VITRO DELIVERY OF MRNA
[001626] [001626] This example describes the fusion of the fusosome with a cell in vitro. In one embodiment, fusion of the fusosome with a cell in vitro results in the delivery of a specified mRNA to the recipient cell.
[001627] [001627] A fusosome produced by the methods described herein has been tested for its ability to deliver a specified mRNA to the recipient cell as follows. In this particular example, the fusosome was a cytobiological (without nucleus), which was generated from a 3T3 mouse fibroblast cell that expressed Cre and GFP. The cytobiological was then treated with the fusogenic HVJ-E protein to produce the fusosome.
[001628] [001628] Receptor mouse macrophage cells were plated on a multi-cell culture plate compatible with the imaging system to be used (in this example, the cells are plated on an image plate with background of glass). The recipient cells stably expressed the "LoxP-stop-LoxP-tdTomato" ribbon under the CMV promoter, which after recombination by Cre induces the expression of tdTomato, indicating the delivery of Cre protein to the recipient cell.
[001629] [001629] Then, 24 hours after the plating of the recipient cells, the Cre recombinase protein expressing fusosome and having the specific fusogenic protein was applied to the receptor cells in DMEM medium. The dose of fusosomes was correlated with the number of recipient cells plated in the well. After the application of the fusosomes, the cell plate was centrifuged at 400g for 5 minutes to help initiate the contact between the fusosomes and the recipient cells. The cells were then incubated for 16 hours and the delivery of MRNA was evaluated by image.
[001630] [001630] The cells were stained with 1 pg / ml of Hoechst 33342 in DMEM medium for 10 minutes before the image. In this example, the cells were photographed in a Zeiss LSM 710 confocal microscope with a 63x oil immersion objective, while kept at 37ºC and 5% CO>. Hoechst was subjected to a 405 nm laser excitation and the emission was recorded through a 430 to 460 nm bandpass filter. The GFP was subjected to laser excitation at 488 nm and the emission was recorded through a bandpass filter from 495 to 530 nm. TdTomato was submitted to a 543 nm laser excitation and the emission was recorded through a bandpass filter from 560 to 610 nm.
[001631] [001631] First, the cells were scanned to positively identify positive cells for single-nucleated tdTomato. The pre-
[001632] [001632] Hoechst, GFP and tdTomato fluorescence analysis on cells of interest was performed using ImageJ software (Rasband, WS, Imagey, US National Institutes of Health, Bethesda, Maryland, USA, rsb.info.nih .gov / ij /, 1997 — 2007). First, the images were pre-processed using a ball-bottom subtraction algorithm with a width of 60 µm. Within a photo-bleached cell, GFP fluorescence was a threshold to remove the background. Then, the mean fluorescence intensity of the GFP for the photo-bleached cell was analyzed at different times before and after the photo-bleaching.
[001633] [001633] In this particular example, the cytobiologicals of 3T3 mouse fibroblasts that express Cre and GFP and which have the applied fusogen HVJ-E (+ fusogen) were applied to recipient mouse macrophage cells that express the "LoxP cassette - stop-LoxP-tdTomato ". Representative images and data are shown in Figure 5. For this particular example, the fluorescence intensity of GFP recovered up to 25% of the original intensity 10 hours after bleaching, indicating the delivery of actively translated mMRNA in the recipient cell. EXAMPLE 97: IN VITRO DELIVERY OF SYRNA
[001634] [001634] This example describes the delivery of short interfering RNA
[001635] [001635] A fusosome produced by the methods described herein is tested for its ability to deliver a specified siRNA to the recipient cell as follows. Fusosomes are prepared as described herein. After the production of the fusosome, it is further electroporated with a siRNA having a sequence that specifically inhibits GFP. The sequence of the double-stranded siRNA directed against GFP is 5th GACGUAAACGGCCACAAGUUC 3 'and its 3rd complement CGCUGCAUUUGCCGGUGUUCA 5' (note that there are 2 long base pairs at the 3 'ends of the siR-NA sequence). As a negative control, fusosomes are electroporated with a siRNA with a sequence that specifically inhibits luciferase. The double stranded siRNA sequence directed against luciferase is 5 'CUUACGCUGAGUACUUCGATT 3' and its complement 3 'TTGAAUG- CGACUCAUGAAGCU 5' (note that there are 2 long base pairs at the 3 'ends of the siRNA sequence).
[001636] [001636] Fusosomes are then applied to recipient cells that constitutively express GFP. The recipient cells are plated on a 96-well black plate with a light background. Then, 24 hours after the plating of the recipient cells, the fososomes they express are applied to the recipient cells in DMEM medium. The dose of fusosomes is correlated with the number of recipient cells plated in the well. After applying the fusosomes, the cell plate is centrifuged at 400 g for 5 minutes to help initiate contact between the fusosomes and the recipient cells. The cells are then incubated for 16 hours and the delivery of the agent,
[001637] [001637] The cells are screened to positively identify GFP positive cells in the field or well. In this example, cell plates are viewed using an automated fluorescence microscope - (www.biotek.com/products/imaging-microscopy- automated-cell-imagers / lionheart-fx-automated-live-cell-Iimager /). The total population of cells in a given well is determined by first staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei interleaving with DNA and is therefore used to identify individual cells. After staining, Hoechst media is replaced by common DMEM media.
[001638] [001638] Hoechst is photographed using the LED filter hub and DAP! 405 nm. GFP is visualized using the 465 nm LED and the GFP filter cube. The images of the different cell groups are obtained by first establishing the LED intensity and the integration times in an untreated well; that is, recipient cells that have not been treated with any fusosomes.
[001639] [001639] The acquisition settings are defined so that the GFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest are then generated by image using the established settings.
[001640] [001640] The analysis of positive GFP wells is performed with the software provided with the fluorescence microscope or other software (Rasband, WS, ImageyJ, US National Institutes of Health, Bethesda, Maryland, USA, http: // rsb.info.nih.gov/ij/, 1997 to 2007). The images are pre-processed using a 60-um wide ball bottom subtraction algorithm. The total cell mask is defined in the Hoechst positive cells. Cells with Hoechst intensity significantly above background intensities are
[001641] [001641] Within the total cell mask, GFP positive cells are identified by again limiting cells significantly above the background and extending Hoechst masks (nuclei) to the entire cell area to include all GFP cell fluorescence . The percentage of GFP positive cells out of the total cells is calculated.
[001642] [001642] In the modalities, the percentage of GFP positive cells in wells treated with fusosomes containing a siRNA against GFP will be at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30% , 40%, 50%, 60%, 70%, 80%, 90% less than the percentage of positive cells for GFP in well treated with fusosomes containing a siRNA against luciferase. EXAMPLE 98: IN VIVO DELIVERY OF MRNA
[001643] [001643] This example describes the delivery of messenger RNA (MRNA) to cells in vivo via fusosomes. In one embodiment, delivery of mMRNA to cells in vivo results in the expression of proteins within the recipient cell. In one embodiment, this delivery method can be used to supplement a protein not present due to a genetic mutation, allowing the cell to behave normally or redirect a cell's activity to perform a function, for example, a therapeutic function.
[001644] [001644] In one embodiment, the delivery of MRNA from the fusosome in vivo demonstrates the delivery of the expression of messenger RNA and protein in the recipient cells within an organism (for example, a mouse).
[001645] [001645] In one embodiment, fusosomes that express a spindle directed to the liver and produce mMRNA expressing Cre are prepared for in vivo delivery.
[001646] [001646] Fusosomes are prepared as described herein. Fusosome suspensions are subjected to centrifugation. Fusosome granules are resuspended in sterile phosphate-buffered saline for injection.
[001647] [001647] Fusosomes are found to express mRNA using a nucleic acid detection method, for example, PCR.
[001648] [001648] The recipient mice harbor a genomic DNA locus of loxp-luciferase that is modified by the CRE protein produced from the MRNA delivered by the fusosomes to unblock the expression of luciferase (JAXH005125). The positive controls for this example are descendants of recipient mice mated with a mouse strain that expresses the same protein exclusively in the liver from its own genome (albumin- CRE JAXH003574). The chicks of this mating house one of each allele (loxp-luciferase, albumin-CRE). Negative controls are performed by injecting recipient mice with fusosomes that do not express fusogens or fusosomes with fusogens but that do not express Cre mRNA.
[001649] [001649] Fusosomes are delivered to mice by intravenous administration of tail veins (IV). The mice are placed in a commercially available mouse limiter (Harvard Apparatus). Before the restriction, the animals are heated by placing their cage in a circulating water bath. Once inside the limiter, animals can get used to it. A | V catheter consisting of a 30G needle tip, a 7.62 cm (3 inch) long PE-10 tube and a 28G needle is prepared and washed with heparinized saline. The tail is cleaned with a 70% alcohol preparation pad. Then, the catheter needle is held with forceps and slowly inserted into the lateral vein of the tail until the blood becomes visible in the tube. Is the fusosome solution (- 500K-5M fusosomes) aspirated into a 1 cm tuberculin syringe and connected to an infusion pump. The fusosome solution is supplied at a rate of 20 ul per minute, for 30 seconds to 5 minutes, depending on the dose. After the infusion is complete, the catheter is removed and pressure is applied to the injection site until any bleeding stops. The mice are returned to their cages and left to recover.
[001650] [001650] After fusion, MRNA is translated into the receptor cytoplasm into CRE protein, which then translocates to the nucleus to perform recombination, resulting in the constitutive expression of luciferase. The intraperitoneal administration of D-luciferin (Perkin Elmer, 150 mg / kg) allows the detection of luciferase expression through the production of bioluminescence. The animal is placed in a bioluminescent imaging chamber in vivo (Perkin Elmer), which houses a cone anesthetic (isoflurane) to prevent the animal from moving. Photon collection is performed between 8 and 20 minutes after injection to observe the maximum in bioluminescence due to the pharmacokinetic clearance of D-luciferin. A specific region of the liver is created in the software and at the defined exposure time of the collection so that the counting rates are above 600 (in this region) to produce interpretable radiation measurements (photons / s / cm2 / steradians). The maximum value of the bioluminescent radiation is recorded as the image of the bioluminescence distribution. Liver tissue is monitored specifically for measurements of brightness above the bottom (untreated animals) and those of negative controls. Measurements are performed 24 hours after the injection to observe luciferase activity. The mice are sacrificed and the livers are harvested.
[001651] [001651] freshly harvested tissue is subject to fixation and incorporation by immersion in 4% paraformaldehyde / 0.1 M sodium phosphate buffer pH 7.4 at 4ºC for 1 to 3 hours. The tissue is then immersed in sterile 15% sucrose / 1xPBS (3 hours at night) at 4ºC. The fabric is then incorporated into the O.C.T. (Baxter No. M7148-4). The fabric is oriented on the block properly for the section (cross section). The tissue is then frozen in liquid nitrogen using the following method: place the lower third of the block in liquid nitrogen, let it freeze until all the center of the PTU is frozen and allow the freezing to end on dry ice. The blocks are sectioned by cryostat in sections of 5 to 7 microns placed on slides and refrozen for staining.
[001652] [001652] In situ hybridization is performed (using standard methods) on tissue sections using RNA probes labeled with digoxygenin (for detection of CRE mMRNA and luciferase mRNA), marked by fluorescent anti-digoxygenin antibodies and observed by confocal microscopy.
[001653] [001653] In one embodiment, positive control animals (eg, recombination by reproduction without fusosome injection) will show bioluminescence intensity in the liver compared to untreated animals (eg, without CRE or fusosomes) and negative controls. In one embodiment, animals injected with a fusosome will show bioluminescence in the liver compared to negative controls (for example, fusosomes without fusogen) and untreated animals.
[001654] [001654] In one embodiment, detection of MRNA in tissue sections in animals administered with fusosomes will reveal detection of CRE recombinase and luciferase mRNA compared to negative controls and untreated animals in tissue cells. In one embodiment, positive controls will show levels of luciferase MRNA and CRE recombinase MRNA throughout the tissue.
[001655] [001655] In one embodiment, evidence of mMRNA delivery by fusosomes will be detected by detection based on in situ hybridization of the MRNA and its colocalization in the animal's recipient tissue. In one embodiment, the activity of the protein expressed from the MRNA delivered by the fusosome is detected by a bioluminescent image. In one embodiment, fusosomes deliver mRNA that will result in protein production and activity. EXAMPLE 99: IN VITRO PROTEIN DELIVERY
[001656] [001656] This example demonstrates the fusion of the fusosome with a cell in vitro. In this example, fusion of the fusosome with a cell in vitro results in the delivery of the Cre protein to the recipient cell.
[001657] [001657] In this example, fusosomes were generated from a mouse 3T3 fibroblast cell having the Sendai virus HVJ-E protein (Tanaka et al., 2015, Gene Therapy, 22 (October 2014), 1-8 doi.org/10.1038/gt.2014.12). In addition, fusosomes expressed Cre recombinase. The target cell was a primary HEK293T cell that stably expressed the "LoxP-GFP-stop- LoxP-RFP" cassette under a CMV promoter, which after Cre recombination alternates from GFP to RFP expression, indicating fusion and Cre , as a marker, delivery.
[001658] [001658] Fusosomes produced by the methods described here were tested for the ability to deliver Cre protein to recipient cells as follows. The recipient cells were plated on a multi-well cell culture plate compatible with the imaging system to be used (in this example, the cells were plated on a black 96-well titration plate with a transparent background). Then, 24 hours after the plating of the recipient cells, the Cre protein recombinase expressing the fusosome and having the specific fusogenic protein was applied to the receptor cells in the DMEM media. The dose of fusosomes was correlated with the number of recipient cells plated in the well. After the application of the fusosomes, the cell plate was centrifuged at 400g for 5 minutes to help initiate the contact between the fusosomes and the recipient cells. The cells were then incubated for 16 hours and the delivery of proteins was evaluated by image.
[001659] [001659] The cells were photographed to positively identify positive cells for RFP versus positive cells for GFP in the field or well. In this example, the cell plates were photographed using an automated microscope. The total cell population in a given well was determined by first staining the cells with 1 µg / ml of Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by interleaving in DNA and is therefore used to identify individual cells. After staining, Hoechst media was replaced with regular DMEM media. Hoechst was photographed using the 405 nm LED and DAPI filter cube. The GFP was photographed using the 465 nm LED and GFP filter cube, while the RFP was photographed using the 523 nm LED and RFP filter cube. The images of the different cell groups were obtained by first establishing the LED intensity and the integration times in a positive control well; that is, cells treated with adenovirus that encode Cre recombinase. The acquisition settings were defined so that the RFP and GFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest were then photographed using the established settings.
[001660] [001660] Analysis of positive Hoechst, GFP and RFP wells was performed using the Gen5 software provided with LionHeart FX or the ImageJ software (Rasband, WS, ImageuJ, US National Institutes of Health, Bethesda, Maryland, USA , http://rsb.info.nih.gov/ij/, 1997-2007). First, the images were pre-processed using a ball-bottom subtraction algorithm with a width of 60 µm. Then, the total cell mask was adjusted to Hoechst positive cells. Cells with Hoechst intensity significantly above background intensities were thresholded and areas too small or large to be Hoechst positive cells were excluded. Within the total cell mask, GFP and RFP positive cells were identified by again limiting the cells significantly above the bottom and extending the Hoechst masks (nuclei) to the entire cell area to include all GFP and RFP cell fluorescence.
[001661] [001661] The number of positive RFP cells identified in the control wells containing only recipient cells was used to subtract from the number of positive RFP cells in the wells containing fusosome (to subtract for non-specific Loxp recombination). The number of RFP positive cells (recipient cells that received the agent) was then divided by the sum of GFP positive cells (recipient cells that did not receive the agent) and RFP positive cells to quantify the fraction of the delivery of the fossa agent. within the population of recipient cells.
[001662] [001662] In this particular example, the 3T3 mouse fibroblast cells that express Cre and that have the fusogen applied HVJ-E (+ fusogen) or not (-fusion) were applied to the 293T cells that express the "LoxP- GFP-stop-LoxP- RFP ". Cre protein delivery is assessed by inducing RFP expression in recipient cells. The graph in Figure 6 shows the quantification of positive RFP cells (bar to the right of each pair) from the total of Hoechst positive stained cells (bar to the left of each pair). For this particular example, the fraction of delivery of the fusosome to recipient cells is 0.44 for Cre 3T3 cells that have HVJ-E fusogen. EXAMPLE 100: IN VIVO PROTEIN DELIVERY
[001663] [001663] This example describes the delivery of therapeutic agents to the eye by fusosomes.
[001664] [001664] Fusosomes are derived from hematopoietic stem cells and parental cells using any of the methods described in the previous Examples and are loaded with a protein that is deficient in the knockout mouse.
[001665] [001665] Fusosomes are injected subretinally into the right eye of a mouse that is deficient in the protein and vehicle control is injected into the left eye of the mice. A subset of the mice is sacrificed when they reach 2 months of age.
[001666] [001666] Histology and H&E staining of the harvested retinal tissue are performed to count the number of cells rescued in each mouse retina (described in Sanges et al., The Journal of Clinical Investigation, 126 (8): 3104 to 3116, 2016).
[001667] [001667] The level of the injected protein is measured in retinas harvested from mice sacrificed at 2 months of age by means of a Western blot with an antibody specific for the PDEG6B protein.
[001668] [001668] In one embodiment, the left eyes of mice, to which fusosomes are administered, will have an increased number of nuclei present at the external nuclear level of the retina compared to the right eyes of mice, which are treated with vehicle . The increase in protein is suggestive of complementation of the mutated PBE6B protein. EXAMPLE 101: DELIVERY TO EDIT THE CONTAINER DNA
[001669] [001669] This example describes fusosomes for delivery of CRISPR-cas9 genome editing machines to an in vitro cell. In one embodiment, delivery of the CRISPR-Cas9 genome editing mechanism to a cell in vitro via a fusosome results in a loss of function of a specific protein in a receptor cell. The genome editing machinery referred to in this example is the S. pyogenes Cas9 protein complexed with a GFP-specific guide RNA (gRNA).
[001670] [001670] In one embodiment, fusosomes are a chassis for the delivery of therapeutic agents. In one embodiment, therapeutic agents such as genome editing machines that can be delivered to cells with high specificity and the efficiency could be used to inactivate the genes and gene products, thus subsequent (for example, proteins ) which, when expressed at high levels or under the wrong cell type, becomes pathological.
[001671] [001671] A fusosome composition as produced by any of the methods described in the previous Examples, except the spindle-sum is manipulated so that the fusosome also includes the S. pyogenes cas9 protein complexed with a guide RNA (gRNA) which is specific to the A. Victoria EGFP sequence. This is achieved by co-nucleofecting a PiggyBac vector that has the open reading frame of the Neomycin resistance gene which is a grid fusion with the open reading structure of S. pyogenes cas9, separated by a P2A cleavage sequence . The additional co-nucleophilic PiggyBac vector also includes the gRNA sequence (GAAGTTCGAGGGCGACACCC) directed by the U6 promoter. As a negative control a fusosome is engineered so that the fusosome includes the protein S. pyogenes cas9 complexed with a mixed gRNA sequence (GCACTACCAGAGCTAACTCA) that is specific for any non-target in the mouse genome.
[001672] [001672] A sufficient number of fusosomes are incubated at 37ºC and 5% CO »together with NIH / 8T3 GFP + cells for a period of 48h in DMEM containing 20% fetal bovine serum and 1x penicillin / streptomycin. After the 48-hour incubation, genomic DNA is prepared and used as a template with specific primers for the region within 500 bp of the predicted gRNA cleavage site in the gene.
[001673] [001673] The PCR amplicon is then purified, sequenced by capillary sequencing and then uploaded to the Tide Calculator, an online tool that quickly assesses CRISPR-Cas9 genome editing of a target locus determined by a guide RNA. Based on quantitative sequence tracking data from two standard capillary sequencing reactions, the software quantifies the effectiveness of editing. An indel (insertion or exclusion) at the predicted site of gRNA cleavage with the GFP locus results in loss of GFP expression in cells and is quantified via FACS using FACS analysis (Becton Dickinson, San Jose, CA, USA) with excitation and 488 nm argon laser emission are collected at 530 +/- 30 nm. FACS software is used for acquisition and analysis. The light scattering channels are defined in linear gains and the fluorescence channels on a logarithmic scale, with a minimum of 10,000 cells analyzed in each condition. The indel and the subsequent loss of the GFP function are calculated based on the intensity of the GFP signal in each sample.
[001674] [001674] In one embodiment, an indel (insertion or exclusion) at the predicted site of gRNA cleavage with the F GFP locus and loss of GFP fluorescence in the cell, compared to the negative control, will indicate the ability to a fusosome to edit DNA and resulted in the loss of protein function in vitro. In one embodiment, fososomes with the encoded gRNA sequence will not demonstrate any or subsequent loss of protein function.
[001675] [001675] This example describes the absence of a teratoma formation with a fusosome. In one embodiment, a fusosome will not result in the formation of a teratoma when administered to a subject.
[001676] [001676] Fusosomes are produced by any of the methods described in a previous example. Fusosomes, tumor cells (positive control) or vehicle (negative control) are injected subcutaneously in PBS in the left flank of the mice (12 to 20 weeks). Teratoma, for example, tumor, growth is analyzed 2-3 times a week by determining the tumor volume by caliper measurements for eight weeks after the injection of spindles, tumor cells or vehicles.
[001677] [001677] In one embodiment, mice administered with fossa or vehicle will not have a measurable tumor formation, for example, teratoma, through caliper measurements. In one embodiment, positive control animals treated with tumor cells will demonstrate an appreciable tumor size, for example, teratoma, as measured by calipers during the eight weeks of observation. EXAMPLE 103: FUSOSOMES DELIVER ACTIVE PROTEIN TO RECEPTOR CELLS OF AN IN VIVO SUBJECT
[001678] [001678] This example demonstrates that fusosomes can deliver a protein to a subject in vivo. This is exemplified by the delivery of the nuclear editing protein Cre. Once inside a cell, Cre translocates to the nucleus, where it recombines and extracts the DNA between two LoxP sites. Cre-mediated recombination can be measured microscopically when the DNA between the two LoxP sites is a stopping code and is upstream of a distal fluorescent protein, such as the red fluorescent protein ttTomato.
[001679] [001679] Fusosomes containing CRE and VSV-G fusogen, acquired from Takara (Cre Recombinase Gesicles, product Takara 631449), were injected into mice B6.Cg-Gt (PINK) 26Sorimº (cAGS- tdTomato) Hze /) (Jackson Laboratories strain 007909). The animals were injected at the anatomical sites, injection volumes and injection sites, as described in Table 14. Mice that do not have tdTomato (FVB.129S6 (B6) -GT (ROSA) 26Sor! Mi (tuclKael / J, Jackson Laboratories strain 005125) and were injected with fusosomes and mice B6.Cg-Gt (ROSA) 26Sor! M14 (CAG-taTomato) Hze /) that were not injected with fusosomes were used as negative controls tives.
[001680] [001680] Two days after the injections, the animals were sacrificed and the samples were collected. The samples were fixed for 8 hours in PFA at 2%, fixed overnight in sucrose at 30% and sent for immediate incorporation in OCT and cut into slides. The slides were stained for nuclei with DAPI. The fluorescence of DAPI and tdTomato was analyzed microscopically.
[001681] [001681] All anatomical sites listed in Table 14 showed fluorescence of tdTomato (Figure 9). In addition, delivery to muscle tissue was confirmed using fluorescence microscopy for tdTomato (Figure 11). The negative control mice had no tissues with tdTomato fluorescence. This result demonstrates that fusosomes are capable of activating the fluorescence of tdTomat in the cells of a mouse at various anatomical sites, and that this does not happen if the mice are not treated with fossa or if they do not have the tdTomato in your genome. Thus, fusosomes deliver active Cre recombinase to the nucleus of mouse cells in vivo.
[001682] [001682] It has also been demonstrated that different routes of administration can supply fusosomes to tissue in vivo. Fusosomes containing CRE and the VSV-G fusogen, purchased from Takara (Cre Re-combinase Gesicles, product Takara 631449), were injected into FVB.129S6 (B6) -GT (PINK) 26Sor! "(LuclKkael / J (strain Jackson Laboratory 005125) intramuscularly (50 ul for the right anterior tibial muscle), intraperitoneally (50 ul for the peritoneal cavity) and subcutaneously (50 ul under the dorsal skin).
[001683] [001683] The legs, the ventral side and the dorsal skin were prepared for intramuscular, intraperitoneal and subcutaneous injection, respectively, epilating the area using a chemical hair remover for 45 seconds, followed by 3 washes with water.
[001684] [001684] On day 3 after the injection, an in vivo imaging system (Perkin Elmer) was used to obtain bioluminescence images in whole animals. Five minutes before the image, the mice received an intraperitoneal injection of bioluminescent substrate (Perkin Elmer) at a dose of 150 mg / kg, in order to visualize the luciferase. The imaging system has been calibrated to compensate for all device settings.
[001685] [001685] Administration by the three routes resulted in luminescence (Figure 10) indicating successful delivery of active Cre recombinase to mouse cells in vivo.
[001686] [001686] In conclusion, fusosomes are capable of delivering active protein to a subject's cells in vivo. EXAMPLE 104: ACID SONICATED MEDIUM LOAD NUCLEIC IN FUSOSOMES
[001687] [001687] This example describes the loading of nucleic acid payloads into a fusosome via sonication. Sonication methods are disclosed, for example, in Lamichhane, TN, et al., Onco-gene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016), the total content of which is incorporated by reference.
[001688] [001688] Fusosomes are prepared by any of the methods described in a previous example. Approximately 10º spindles are mixed with 5 to 20 µg of nucleic acid and incubated at room temperature for 30 minutes. The fusosome / nucleic acid mixture is then sonicated for 30 seconds at room temperature using a water bath sonicator (Brason model t41510R-DTH) operated at 40kHz. The mixture is then placed on ice for one minute, followed by a second round of sonication at 40kHz for 30 seconds. The mixture is then centrifuged at 16,000 g for 5 minutes at 4ºC to granulate the fusosomes containing nucleic acid. The supernatant containing unincorporated nucleic acid is removed and the granule is resuspended in phosphate buffered saline. After loading the DNA, the fusosomes are kept on ice before use. EXAMPLE 105: SONICATION-MEDIATED PROTEIN LOAD IN FUSOSOMES
[001689] [001689] This example describes the loading of protein payloads into a fusosome via sonication. Sonication methods are disclosed, for example, in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016), the total content of which is incorporated by reference.
[001690] [001690] Fusosomes are prepared by any of the methods described in a previous example. Approximately 10º spindles are mixed with 5 to 20 µg of protein and incubated at room temperature for 30 minutes. The fusosome / protein mixture is then sonicated for 30 seconds at room temperature using a water bath sonicator (Brason% & 1510R-DTH model) operated at 40kHz. The mixture is then placed on ice for one minute, followed by a second round of sonication at 40kHz for 30 seconds. The mixture is then centrifuged at 16,000 g for 5 minutes at 4ºC to granulate fusosomes containing protein. The supernatant containing unincorporated protein is removed and the granule is resuspended in phosphate buffered saline. After loading proteins, the fusosomes are kept on ice before use. EXAMPLE 106: TRANSPORT-MEDIATED HYDROPHOBIC LOAD NUCLEIC ACID CARRIER IN FUSOSOMES
[001691] [001691] This example describes the loading of nucleic acid payloads into a fusosome by means of hydrophobic carriers. Exemplary hydrophobic charge methods are disclosed, for example, in Didiot et al., Exosome-mediated Delivery of Hydrophobicly Modified siRNA for Huntingtin mMRNA Silencing, Molecular The-
[001692] [001692] Fusosomes are prepared by any of the methods described in a previous example. The 3 'end of an RNA molecule is conjugated to a bioactive hydrophobic conjugate (triethylene glycol-cholesterol). Approximately 10º fusosomes are mixed in 1 ml with 10 umol / l of siRNA conjugate in PBS by incubation at 37 ºC for 90 minutes with agitation at 500 rpm. The hydrophobic carrier mediates the association of RNA with the fossa membrane. In some embodiments, some RNA molecules are incorporated into the lumen of the fusosome and some are present on the surface of the fusosome. Discharged fusosomes are separated from RNA-loaded fusosomes by ultracentrifugation for 1 hour at 100,000 g, 4 ºC in a table ultracentrifuge using a TLA-110 rotor. The discharged fusosomes remain in the supernatant and the fusosomes loaded with RNA form a granule. RNA-loaded fusosomes are resuspended in 1 ml of PBS and kept on ice before use. EXAMPLE 107: FUSOSOMES PROCESSING
[001693] [001693] This example described the processing of fusosomes. Fusosomes, produced using any of the methods described in the previous Examples, can be further processed.
[001694] [001694] In some embodiments, fusosomes are first homogenized, for example, by sonication. For example, the sonication protocol includes a 5 second sonication using an MSE sonicator with a microprobe in an amplitude setting of 8 (Instrumentation Associates, NY). In some modalities, this short ultrasound period is enough to cause the plasma membrane of the fusosomes to divide into size fusosomes.
[001695] [001695] Extrusion of fusosomes through a commercially available polycarbonate membrane (for example, from Sterli- tech, Washington) or an asymmetric ceramic membrane (for example, Membralox), commercially available from Pall Execia, France, it is an effective method for reducing fusosome sizes to a relatively well-defined size distribution. Typically, the suspension is interrupted across the membrane one or more times until the desired size fusosome distribution is achieved. Fusosomes can be extruded through successively smaller pore membranes (e.g., 400 nm, 100 nm and / or 50 nm pore size) to achieve a gradual reduction in size and uniform distribution.
[001696] [001696] In some modalities, in any fusosome production step, although, generally, before homogenization, ultrasound and / or extrusion steps, a pharmaceutical agent (for example, a therapeutic agent), can be added to the mixture of reaction in such a way that the resulting fusosome encapsulates the pharmaceutical agent. EXAMPLE 108: MEASUREMENT OF TOTAL RNA IN A FUEL CELL SOSOME AND SOURCE
[001697] [001697] This example describes a method to quantify the amount of RNA in a fusosome in relation to a source cell. In one embodiment, a fusosome will have RNA levels similar to the source cell. In this assay, RNA levels are determined by measuring total RNA.
[001698] [001698] Fusosomes are prepared by any of the methods
[001699] [001699] In one modality, the concentration of RNA in the spindles will be 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% of concentration of source cells per protein mass. EXAMPLE 109. CREATION OF HEK-293T CELLS THAT EXPRESS SAM EXOGENOUS FUSOGEN
[001700] [001700] This example describes the creation of tissue culture cells that express an exogenous fusogen. A fusogenic gene, VSV-G (vesicular stomatitis virus protein G), was cloned into the pcDNA3.1 vector (ThermoFisher). The VSV-G construct was then transfected into HEK-293T cells (ATCC, Catalog No. CRL-3216) using Xfect transfection reagent (Takara). The transfected HEK-293T cells were cultured at 37ºC, 5% CO, in Dulbecco Modified Eagle Medium (DMEM) supplemented with Glutamax (Gibco), 10% fetal serum calf (GIBCO), and penicillin antibiotics / streptomycin (GIBCO) for the appropriate duration before using for other experiments. EXAMPLE 110. DELIVERY OF MITOCHONDRIA THROUGH FUSOGENIC ENUCLEATED CELLS WITH IMPROVED PROTEIN RADA
[001701] [001701] Fusogenic enucleated cells were generated comprising a HeLa cell that expresses the vesicular stomatitis virus (GVV-G) glycoprotein on the cell surface and enhanced by proteins when expressing the fluorescent protein DSRED directed to mitochondria (mMtDsRED). HeLa cells expressing VSV-G were enucleated according to the standard ultracentrifugation procedure through a Ficoll gradient to obtain enucleated cells (for example, as described in Example 1). The recipient cell was a HeLa Rho0 cell, which had been produced with a lack of mitochondrial DNA (mMtDNA) by long-term culture (> 6 weeks) of HeLa cells in zalcitabine, a nucleoside analog reverse transcriptase inhibitor. HeLa Rho0 cells are deficient in mtDNA (as assessed by qQPCR) and show significantly deficient mitochondrial oxygen consumption (as measured by the Seahorse extracellular flow test). HeLa Rhoo0 receptor cells were also modified to express the mitochondrial target GFP (mtGFP) via adenoviral transduction for 2 days.
[001702] [001702] HeLa Rho0 receptor cells were placed in 6-well plates and one hour later enucleated VSV-G He-La cells were applied to the recipient cells. The cells were then incubated for 24 hours at 37ºC and CO; to 5%. The cells were then classified into doubly positive (fused) cells by fluorescence-assisted cell screening using a BD FACS Aria SORP cell classifier. The population of doubly positive cells for mtGFP and mtDsRED was evaluated to classify recipient HeLa Rho0O cells that received mitochondrial donation (mtDs-RED) from enucleated VSV-G HeLa cells. MtGFP was excited with a 488nm laser and the emission captured at 513 +/- 26nm. MtDsRED was excited with a 543nm laser and the emission captured at 570 +/- 26nm. The front and side scatter ports were initially used to capture cell-sized events and discard small debris. The doubly positive events for mtGFP and mtDsRED were determined by blocking at the minimum level for which each suitably negative control sample showed <1% of positive events for the specific fluorescent marker (ie, spot-free and unique samples of positive mtGFP show <1% positive events for mtDsRED). The doubly positive events, as well as the single positive mtGFP events (recipient cells without mitochondrial delivery) and single positive mtDsRED (VSV-G HeLa cells enucleated by donors that do not fuse with the recipient cells) were then classified in the DMEM media with 10% SFB and antibiotics. The classified cells were counted and seeded in 25,000 cells per well (in 6 replicates for each group) in a 96-well Seahorse plate (Agilent). The plate was incubated at 37 ° C and 5% CO, »for 24 hours.
[001703] [001703] Oxygen consumption tests were initiated by removing the growth medium, replacing it with a minimum DMEM medium with low buffer containing 25bmM glucose and 2mM glutamine (Agilent) and incubating at 37ºC for 60 minutes to allow temperature and pH to reach equilibrium. The microplate was then analyzed in the XF96 extracellular flow analyzer (Agilent) to measure changes in extracellular flow of oxygen and pH in the medium immediately surrounding the adherent cells. After obtaining steady state oxygen consumption and extracellular acidification rates, oligomycin (5 µM), which inhibits ATP synthase, and the proton ionophore FCCP (carbonyl cyanide 4- (trifluoromethoxy) phenylhydrazone; 2 µM) , which decouples mitochondria, were injected sequentially through reagent distribution chambers for each cell in the microplate to obtain values for maximum oxygen consumption rates. Finally, 5 µM of antimycin A (inhibitor of the mitochondrial complex III) was injected to confirm that the respiratory changes were mainly due to mitochondrial breathing. Antimycin A respiration rates were subtracted from the other three respiration rates to determine baseline, uncoupled mitochondrial respiration rates
[001704] [001704] Using this assay, it was determined that the HeLa cells of the VSV-G donor had active rates of basal and maximum oxygen consumption, while the target cells without delivery had low rates of the three states of mitochondrial oxygen consumption. . The delivery of mitochondria with enucleated VSL-G HeLa cells and protein-enhanced to recipient HeLa Rho0 cells showed a return to mitochondrial oxygen consumption rates close to the rates of donor VSV-G HeLa cells (Figure 12). EXAMPLE 111: FUSOSOMES GENERATION AND ISOLATION THROUGH THE FORMATION OF VESICLES AND CENTRIFUGATION
[001705] [001705] This example describes the generation and isolation of spindles by vesiculation and centrifugation. This is one of the methods by which fusosomes are isolated. Fusosomes were prepared as follows. 9.2 x 10 th HEK-293T cells (ATCC, catalog number CRL-3216) were reverse transfected using Xfect transfection reagent (Takara, catalog number 631317) with 10 µg of the pcDNA3.1 expression plasmid containing the reading frame open for VSVg and 15ug of the expression plasmid pcDNA3.1 containing the open reading frame for bacteriophage P1 Cre recombinase with a Nuclear SV40 localization sequence in 7.5 ml of complete medium (Eagle medium modified by Dulbecco (DMEM) supplemented with GlutaMAX (ThermoFisher), 10% fetal calf serum (Thermo-Fisher) and penicillin / streptomycin antibiotics (ThermoFisher)) in a 100 mm collagen-coated plate (Corning). Twelve hours after sowing, the medium was aspirated and carefully replaced with 15 ml of fresh complete medium supplemented with 100 µM ATP (Sigma). The supernatants were then collected 48 hours after transfection, clarified by centrifugation (2000xg, 10 minutes), filtered through a 0.45 µm PES filter (CellTreat) and ultracentrifuged.
[001706] [001706] This example describes the generation, loading and isolation of the fusosome via cell vesiculation and centrifugation. This is one of the methods by which fusosomes can be generated, isolated and charged.
[001707] [001707] Fusosomes were prepared as follows. 9.2 x 10 6 HEK-293T cells were reverse transfected using a polymeric transfection reagent with 10 µg of the expression plasmid pcDNA3.1 containing the open reading frame for VSVg and 15 µg of the expression plasmid pcDNA3.1 containing the reading frame open for bacteriophage P1 Cre Recombinase with a Nuclear SV40 locating sequence in 7.5 ml! complete medium (DMEM + 10% FBS + 1x Pen / Strep) in a 100 mm collagen-coated plate.
[001708] [001708] To produce charge-loaded fusosomes, 24 hours after transfection, cells were washed twice in wash buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM CaCl2) and once in formation buffer (10 mM HEPES, pH 7.4, 2 mM CaCl2, 150 mM NaCl, 25 mM PFA, 2 mM DTT, 125 mM glycine). The cells were then incubated at 37ºC in formation buffer for a minimum of 6 hours. The supernatant containing the fusosomes was harvested and the fusosomes were then clarified from cells and cell debris by a 5 minute centrifugation at 2,000 x g. Finally, the fusosomes were concentrated by means of a 20 minute centrifugation at 17,000 xg and resuspended in the desired buffer for experimentation. To test whether fusosomes can fuse with recipient cells and deliver their charge, resuspended fusosomes were added to the reporter cells of the 293T LoxP Green / Red switch at the desired dose. To verify the fusion of the vesicles and the delivery of the charge, the LoxP recombination of the recipient cells was photographed using an automatic fluorescence microscope (www.biotek.com/ products / imaging-microscopy-automated-cell-imagers / lionheart-fx-auto - mated-live-cell-mager /). To positively identify cells positive for RFP in the field of view, the total population of cells in each well was determined by first staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei interspersed with DNA and can therefore be used to identify individual cells. After staining, Hoechst medium was replaced with regular DMEM medium and RFP + cells were identified.
[001709] [001709] Hoechst stain was photographed using a 405 nm LED and DAPI filter cube. The RFP was photographed using a 523 nm LED and RFP filter tube. The images of the different groups of cells were obtained by first establishing the intensity of the LED and the integration times in an untreated well; that is, recipient cells that have not been treated with any fusosomes. The acquisition settings were defined so that the RFP intensities would reach the maximum pixel intensity values, but not saturated. The wells of interest were then photographed using the established settings.
[001710] [001710] The analysis of the positive wells for RFP was performed with the Gen 5 software (BioTek) supplied with the fluorescence microscope. The images were pre-processed using a rolling ball bottom subtraction algorithm 10 μm wide (Hoechst 33342) and 1 μm wide (RFP). The total cellular mask was adjusted in the
[001711] [001711] Within the total cell mask, RFP positive cells were identified by again limiting cells significantly above the bottom and extending Hoechst masks (nuclei) to the entire cell area to include all RFP cell fluorescence. The total number of RFP positive cells from the total per field of view was calculated. In one embodiment, recipient cells treated with a fusosome had more RFP + cells per field of view than untreated cells (Figure 13). EXAMPLE 113: GENERATION OF FUSOSOMES BY EXTRUSION
[001712] [001712] This example describes the manufacture of fusosomes by extrusion through a membrane.
[001713] [001713] HEK293T cells expressing VSV-G and Cre recombinase were trypsinized with TrypleE, collected, centrifuged at 500 x g for 5 min and counted. 30 x 10 th cells were then resuspended in 1 ml of 12.5% Ficoll in DMEM medium supplemented with 500 nM Latrunculin B for 30 minutes at 37 ° C. To enumerate cells, they were transferred to a batch gradient. Ficoll consisting of the following Ficoll fractions (from top to bottom): 5 ml of Ficoll at 12.5%, 6 ml of Ficoll at 16% and 10 ml of Ficoll at 18%. All Ficoll gradient fractions were made in DMEM medium supplemented with 500 nM latrunculin B. The gradients were rotated in a Beckman SW-40 ultracentrifuge with a Ti-70 rotor at 32,300 RPM for 1 h at 37ºC. After centrifugation, HEK293T enucleated cells were collected from the gradient between Ficoll layers of 12.5% and 16% and diluted with PBS, and spun at 3000 xg for 5 min. The enucleated cells were then resuspended in 1 ml of PBS.
[001714] [001714] Briefly, for extrusion, HEK293T fusogenic enucleated cells were resuspended at a density of 1 5 mg / ml of protein, as tested by the PBS Bicinchoninic Acid Assay. The cells were aspirated with a 1 ml watertight syringe and passed through a 5 µm, 0.8 µm or 0.4 µm membrane between 1 and 20 times. The filtrate was collected and added to a 96-well titration plate containing HEK293T cells that stably expressed a loxP: GFP / RFP reporter construct. After 16 to 24 hours, the plate was photographed and analyzed for RFP expression (Figure 14). EXAMPLE 114: INSULATION OF FUSOGENIC MICROVEILS CAS RELEASED FREELY FROM CELLS
[001715] [001715] This example describes the isolation of fungal microvesicles released freely from the cells. Fusogenic microvesicles were isolated as follows. 9.2 x 106 HEK-293T cells (ATCC, catalog number CRL-3216) were reverse transfected using Xfect transfection reagent (Takara, catalog number 631317) with 10 µg of the pcDNA3.1 expression plasmid containing the grid open reading frame for VSVg and 15ug of the expression plasmid pcD-NA3.1 that contains the open reading frame for bacteriophage P1 Cre Recombinase with a Nuclear SV40 localization sequence in 7.5 ml of complete medium (Eagle medium modified by Dulbecco (DMEM) supplemented with GlutaMAX (ThermoFisher), 10% fetal calf serum (ThermoFisher) and penicillin / streptomycin antibiotics (ThermoFisher)) in a 100 mm collagen-coated plate (Corning). Twelve hours after sowing, an additional 7.5 ml of complete medium was carefully added. The cells were separated from the culture media by centrifugation at 200 x g for 10 minutes. The supernatants were collected and centrifuged sequentially twice at 500 x g for 10 minutes, once at 2,000 x g for 15 minutes, once at 10,000 x g for 30 minutes and once at 70,000 x g for 60 minutes. The freely released fusosomes were granulated during the final centrifugation step, resuspended in PBS and repelled at 70,000 x g. The final granule was resuspended in PBS.
[001716] [001716] See also Wubbolts R et al. Proteomic and Biochemical Analyzes of Human B Cell-derived Exosomes: Potential Implications for their Function and Multivesicular Body Formation. J. Biol. Chem. 278: 10963 to 10972 2003. EXAMPLE 115: LACK OF TRANSCRIPTIONAL ACTIVITY IN FU- SOSOMES
[001717] [001717] This example describes the quantification of transcriptional activity in fusosomes compared to parental cells, for example, source cells, used for generating fusosomes. Transcriptional activity may be low or absent in fusosomes compared to parental cells, for example, cells of origin.
[001718] [001718] Fusosomes can be used as a chassis for the delivery of therapeutic agents. Therapeutic agents such as mIRNA, MRNAs, proteins and / or organelles that can be delivered to cells or local tissue environments with high efficiency can be used to modulate pathways that are not normally active or active at low or high pathological levels in the recipient tissue. The observation that fusosomes may be incapable of transcription or that fusosomes may have less transcriptional activity than the parental cell may demonstrate that the removal of nuclear material has occurred sufficiently.
[001719] [001719] Fusosomes were prepared as described here. Control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. Transcriptional activity of fusosomes was then compared to parental cells, for example, source cells, used for the generation of fusosomes using the same UE image processing kit (ThermoFisher).
[001720] [001720] In summary, approximately 3x10º fusosomes corresponding to 60 µl of a standard VSV-G fusosome preparation and 1x10º parental cells used to generate the fusosomes were plated in triplicate, 1 ml of complete medium in a multiple well. 6 wells and low attachment complete plate containing 1 mM of EU alkaline nucleoside fluorescence-marked for 4 hours at 37ºC and 5% CO ». For the negative control, 3x10º fusosomes were plated in a multi-well plate with low fixation and 6 wells in complete medium, but without EU alkaline nucleoside. After the 4 hours of incubation, the samples were processed following the manufacturer's instructions (ThermoFisher Scientific). Briefly, the cell and fusosome samples, including negative controls, are washed three times with 1xPBS buffer and resuspended in buffer 1xPBS and analyzed by flow cytometry (Attune, ThermoFisher) using a 488nm argon laser for excitation and 530 +/- 30nm filter emission, as shown in the table below:
[001721] [001721] Attune NxT software was used for acquisition and FlowJo analysis. For data acquisition, the FSC and SSC channels were adjusted on the linear axis to determine a representative population of cells or fusosomes. This population was then blocked and events only within this gate were used to display events in the 530 +/- 380nm emission channel on a logarithmic scale. A minimum of 10,000 events within the cells or spindle ports
[001722] [001722] This example describes the quantification of DNA replication activity in fusosomes compared to parent cells, for example, source cells, used for spindle generation. DNA replication activity may be low or absent in fusosomes compared to parental cells, for example, parent cells.
[001723] [001723] Fusosomes can be used as a chassis for the delivery of therapeutic agents. Therapeutic agents such as miRNA, MRNAs, proteins and / or organelles that can be delivered to cells or local tissue environments with high efficiency can be used to modulate pathways that are not normally active or active at low or high pathological levels in the recipient tissue. The observation that fusosomes may be unable to replicate DNA, or that fososomes may have less DNA replicating activity than the parental cell, may demonstrate that the removal of nuclear material has occurred sufficiently.
[001724] [001724] Fusosomes were prepared as described here. Control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. The translational activity of the fusosomes was then compared to parental cells, for example, origin cells, used for the generation of the fusosome using the Click-iT EdU Imaging kit (ThermoFisher).
[001725] [001725] In summary, approximately 3x10 th fusosomes corresponding to 60 ul of a standard VSV-G fusosome preparation and 1x108 parental cells used to generate the fusosomes were plated in triplicate, 1 ml of complete medium in a multiple well of 6 wells and low attachment plate in full containing 1 mM fluorescent taggable-alkaline-nucleoside EdU for 4 hours at 37ºC and 5% CO ». For the negative control, were 3x10º fusosomes were plated on a 6-well low-fixation multi-well plate in complete medium, but without alkaline-nucleoside EdU. After 4 hours of incubation, the samples were processed according to the manufacturer's instructions (ThermoFisher Scientific) In short, the cell and fusosome samples, including negative controls, are washed three times with 1xPBS buffer and resuspended in buffer. 1xPBS bread and analyzed by flow cytometry (Attune, ThermoFisher) using a 638nm laser for excitation and 670 +/- 14nm filter emission, as shown in the table below:
[001726] [001726] Attune NxT software was used for acquisition and FlowJo analysis. For data acquisition, the FSC and SSC channels were adjusted on the linear axis to determine a representative population of cells or fusosomes. This population was then blocked and events only within that gate were used to display events in the 670 +/- 14nm emission channel on a logarithmic scale. A minimum of 10,000 events within the cells or spindle port were collected for each condition. For data analysis, the FSC and SSC channels were adjusted on the linear axis to determine a representative population of cells or fusosomes. This population was then blocked and events only within that gate were used to display events on the 670 +/- 14nm emission channel on a logarithmic scale. The control emission negative control 670 +/- 14 nm was used to determine where to place the port in the histogram, so that the inclusion of less than 1% positive was less. The use of the analysis criteria listed above in parental cells showed 56.17% + 8.13 Edu events: 647, as a substitute measure for translation activity, including Edu in the newly synthesized DNA, where Fusosomes demonstrated 6.23% + 4.65 AF488 events (Figure 14C). The median fluorescence intensity of AF647, a measure of Edu incorporation and, therefore, the newly synthesized DNA was 1311 + 426.2 for parental cells and 116.6 + 40.74 for fusosomes (Figure 14C). The example demonstrates that fusosomes have no DNA replication activity in relation to parental cells.
[001727] [001727] This example describes a composition of fusosomes. In one embodiment, the fusosome composition comprises a lipid bilayer structure, with a lumen in the center. Without wishing to be bound by theory, the lipid bilayer structure of a fososome promotes fusion with a target cell and allows fososomes to carry different therapies.
[001728] [001728] Fusosomes were prepared as described in the previous Examples by transient transfection of 293F cells with VSV-G, followed by filtration and ultracentrifugation of conditioned media 48 h after transfection. For each sample, small molecular weight contaminants were removed with exosome rotation columns (Invitrogen tt 4484449) according to the manufacturer's instructions. The removal of large proteins, desalination and the exchange of buffers were performed using an Ultracel 100K unit
[001729] [001729] This example describes the quantification of fusogen expression in fusosomes. Fusosomes were prepared as described herein by transient transfection of HEK293T with VSV-G, Cre recombinase and miRFP670 in 10 cm plates, followed by filtration and ultracentrifugation of the conditioned medium 48 h after transfection to obtain fusosomes. The positive control was 293T cells transiently transfected unprocessed. The negative controls were non-transferred 293T cells.
[001730] [001730] Fusosomes were lysed with RIPA buffer and centrifuged at 15,000 xg for 10 minutes, after which the protein was recovered from the supernatant. The samples were run with a denaturing SDS-PAGE gel of 4 to 12% Bis-Tris and then transferred to a PVDF membrane. Each membrane was blocked for 30 minutes in 3% BSA + 0.1% Triton X-100 in PBS. The membranes were then incubated with primary anti-VSVG tag antibody (ab1874, Abcam, Cambridge, MA) in the blocking solution overnight at 4 ºC, then washed three times for 5 minutes each in Triton X-100 at 0, 1% in PBS. The membranes were then incubated with a secondary antibody conjugated to HRP (tt 7074P2, Cell Signaling Technologies, Danvers, MA) in the blocking solution for 4 hours at 4ºC. The HRP substrate was added and the chemiluminescent signal was registered by an Alpha Innotech Multilmage3 (Figure 16). EXAMPLE 119: MEASUREMENT OF THE AVERAGE SIZE OF THE SPINDLES BUT
[001731] [001731] This example describes the measurement of the average size of the fusosomes.
[001732] [001732] Fusosomes were prepared as described herein by transient transfection of HEK293T with VSV-G, enucleation and subsequent fractionation with Ficoll. Fusosomes were measured to determine the average size using commercially available systems for submicron (Nanosight NS300, Malvern Instruments) and supra-micron (Zeiss 780 Inverted Laser Confocal, Zeiss) measurements. Each system was used with the software according to the manufacturer's instructions. Fusosomes and parental cells were resuspended in PBS and stained with 1 µM of CalceinAM to a final concentration of approximately 1 mg of protein / ml. Fusosomes and parental cells were then diluted 100 times in PBS before measurement. For submicron measurements on the Nanosight NS300, the parameters shown in Figure 17A were used. For supra-micron measurements on the 780 inverted confocal microscope, the parameters shown in Figure 17B were used.
[001733] [001733] All fusosomes were analyzed within 8 hours after isolation. Measurements for particles <500 nm were taken at the NTA and added to measurements for particles> 500 nm under the Zeiss microscope to obtain a complete measurement from 50 to 20,000 nm. The size distribution of fusosomes and parental cells is shown in Figure 17C. The distribution of all particles was calculated to obtain the average size of the fusosomes, as shown in Figure 17D. It is contemplated that fusosomes may be smaller in size than parental cells. It is contemplated that spindles can have a size within about 73% of parental cells. EXAMPLE 120: MEASUREMENT OF AVERAGE SIZE DISTRIBUTION FUSOSOMES
[001734] [001734] This example describes the measurement of the size distribution of the fusosomes.
[001735] [001735] Fusosomes were prepared as described herein by transient transfection of HEK293T with VSV-G, enucleation and subsequent fractionation with Ficoll. Fusosomes were measured to determine the size distribution using the method of Example 30, as shown in Figure 18. It is contemplated that fusosomes can be less than about 50%, 40%, 30%, 20%, 10%, 5 % or less of the parental cell variability in the size distribution within 90% of the sample. It is contemplated that fusosomes may have 58% less parental cell variability in the size distribution within 90% of the sample. EXAMPLE 121: AVERAGE VOLUME OF FUSOSOMES
[001736] [001736] This example describes the measurement of the average volume of fososomes. The variation in the size (for example, volume) of the spindles can make them versatile for different loads, therapeutic design or application.
[001737] [001737] Fusosomes were prepared as described herein by transient transfection of HEK293T with VSV-G, enucleation and subsequent fractionation with Ficoll. The positive control was HEK293T cells.
[001738] [001738] Analysis with a combination of NTA and focal microscopy as described in Example 30 was used to determine the size of the fusosomes. The diameter of the fusosomes was measured and the volume calculated, as shown in Figure 19. It is contemplated that the fusosomes can have an average size greater than 50 nm in diameter. It is contemplated that fusosomes can have an average size of 129 nm in diameter. EXAMPLE 122: MEASUREMENT OF ORGANELES CONTENT IN SPINDLES SUMMITS
[001739] [001739] This example describes the detection of organelles in spindles.
[001740] [001740] Fusosomes were prepared as described herein by transient transfection of HEK293T cells with VSV-G, enucleation and subsequent fractionation with Ficoll. For the detection of endoplasmic reticulum (ER), lysosomes and mitochondria, fusosomes or HEK293T cells were stained with ER 1 uM staining (E34251, Thermo Fisher, Waltham, MA), 50 nM lysosome staining (L7528, Thermo Fisher Waltham, MA) or 100 nM mitochondria stain (M22426, Thermo Fisher Waltham, MA), respectively.
[001741] [001741] The spotted fusosomes were run in a flow cytometer (Thermo Fisher, Waltham, MA) and the fluorescence intensity was measured for each dye, according to the table below. Validation for the presence of organelles was performed by comparing the fluorescence intensity of spotted fusosomes with non-spotted fusosomes (negative control) and stained cells (positive control). Fusosome spots were performed using the microscopy settings shown in Table Y: TABLE Y: Attune laser wave (nm)
[001742] [001742] As shown in Figure 20, fusosomes stained positively for endoplasmic reticulum (Figure 20A), mitochondria (Figure 20B) and lysosomes (Figure 20C) at 4 hours after enucleation. EXAMPLE 123: COMPARISON OF SOLUTE PROTEIN MASS INSOLUBLE SPEED
[001743] [001743] This example describes the quantification of the soluble: insoluble ratio of the mass of proteins in fusosomes. The soluble: insoluble ratio of the mass of proteins in fusosomes can, in some cases, be similar to that of nucleated cells.
[001744] [001744] Fusosomes were prepared as described here by transient transfection of HEK293T with VSV-G, enucleation and fractionation
[001745] [001745] The fusosomes or cells were then resuspended in PBS. This suspension represents the fraction of insoluble protein.
[001746] [001746] A standard curve was generated using the supplied BSA, from 0 to 15 µg BSA per well (in duplicate). The preparation of fusosomes or cells was diluted so that the amount measured is within the range of the standards. The fusosome preparation was analyzed in duplicate and the mean value was used. The concentration of soluble protein was divided by the concentration of insoluble protein to produce the ratio of soluble protein: insoluble (Figure 21). EXAMPLE 124: FUSION MEASUREMENT WITH A TARGET CELL
[001747] [001747] Fusosomes derived from HEK-293T cells that express the measles virus engineered hemagglutinin glycoprotein (MvH) and fusion protein (F) on the cell surface and containing Cre recombinase protein were generated, as is described here. MvH was designed to decrease its natural binding to the receptor and provide target cell specificity through a single chain anbitody (scFv) that recognizes the cell surface antigen; in this case, scFv is designed to target CD8, a co-receptor for the T cell receptor. A control fusosome, derived from HEK-293T cells that express the VSV-G fusogen on its surface, was used. that contains the Cre recombinase protein. The target cell was a HEK-293T cell designed to express a "Loxp-GFP-stop-Loxp-RFP" cassette under the CMV promoter, as well as designed to suppress the CD8a and CD8b co-receptors. The non-target cell was the same HEK-293T cell that expressed the "Loxp-GFP-stop- Loxp-RFP" cassette, but without overexpression of CD8a / b. The target or non-target recipient cells were seeded 30,000 cells / well in a 96-well, light-well, black bottom titration plate and cultured in DMEM medium with 10% fetal bovine serum at 37 ° C and 5% CO>. Four to six hours after the plating of the recipient cells, the spindles that express the recombinase protein Cre and MvH + F were applied to the target or non-target recipient cells in the DMEM media. Recipient cells were treated with 10 µG of fusosomes and incubated for 24 hours at 37ºC and 5% CO>.
[001748] [001748] Cell plates were photographed using an automated microscope (www.biotek.com/products/imaging-microscopy- automated-cell-imagers / lionheart-fx-automated-live-cell-Iimager /). The total population of cells in a given well was determined by staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by interleaving in DNA and is therefore used to identify individual cells. Hoechst was photographed using the 405 nm LED and DAPI filter cube. GFP was photographed using the 465 nm LED and GFP filter cube, while the RFP was photographed using the 523 nm LED and RFP filter cube. Images of wells of target and non-target cells were acquired by first establishing the LED intensity and integration times in a positive control well; that is, recipient cells treated with adenovirus that encode Cre recombinase instead of fusosomes.
[001749] [001749] The acquisition settings were defined so that the Hoescht, RFP and GFP intensities reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, with automatic focus on the Hoescht channel and then using the focal plane established for the GFP and RFP channels. The analysis of cells positive for GFP and RFP was performed with the GenB5 software provided with an automatic fluorescent microscope (https://www.biotek.com/products/software-robotics-software/gen5- microplate-reader-and-imager -software /).
[001750] [001750] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive RFP cells (recipient cells that receive Cre) was then divided by the sum of the positive cells for GFP (recipient cells that did not deliver) and positive cells for RFP to quantify the percentage conversion of RFP , which describes the amount of fusosome fusion in the target and non-target recipient cell population. For amounts of targeted fusion (fusosome fusion for targeted recipient cells), the percentage value of RFP conversion is normalized to the percentage of recipient cells that are target recipient cells (that is, expressing CD8), which was evaluated by co- phyterythrin (PE) conjugated anti-CD8 antibody and analyzed by flow cytometry. Finally, the absolute amount of target fusion was determined by subtracting the amount of non-target cell fusion from the amount of target cell fusion (any value <0 was assumed to be 0).
[001751] [001751] With this assay, the fusosome derived from a HEK-293T cell that expresses the MvH (CD8) + F manipulated on its surface
[001752] [001752] HEK-293T cell fusosomes expressing the syncytin-1 placenta cell-cell fusion protein (Syn1) and the membrane protein, human Ox40 ligand (hOx40L, CD134 ligand), on the cell surface were generated as described here. Control particles (non-fusogenic fusosomes) from the same cells that express hox40L, but not Syn1, were also generated to control the delivery of non-fusion-mediated hOx40L to the recipient cells. The recipient cells were human prostate cancer cells (PC-3), which were plated at 120,000 cells / well in a 24-well tissue culture plate, 4 to 6 hours before treatment with fusosomes. Recipient cells were treated with 40 µg of Syn1 fososomes or control particles at t = O and incubated for 24 hours at 37ºC and 5% CO.
[001753] [001753] After incubation with fusosomes or particles for 24 hours
[001754] [001754] The cells were then analyzed for BV421 and propidium iodide fluorescence using an Attune NxT flow cytometer (Thermo Fisher, Waltham, MA) to determine the fluorescence intensity of each fluorophore according to Table Z below. TABLE Z. FLOW CYTOMETER SETTINGS Attune laser wave
[001755] [001755] Negative controls are generated using the same staining procedure, but without the addition of a primary antibody. The Attune NxT acquisition software is used for acquisition and the FlowJo software is used for analysis. The light scattering channels are defined in linear gains and the fluorescence channels in a logarithmic scale, with a minimum of 10,000 cells analyzed in each con-
[001756] [001756] With this assay, the fusosome derived from a HEK-293T cell that expresses Syn1 and hox40L showed a percentage of cells with 43.6% hox40L delivery to PC-3 receptor cells. Control particles without Syn1 expression showed a percentage of cells with hox40L delivery of 11.4%. The amount of hox40L delivery observed with control particles represented the background level of hox40L delivery resulting from non-fusosome-mediated delivery. Thus, to calculate the percentage of cells with fusosome-mediated hox40L delivery, the percentage of cells with hox40L delivery under the control particle treatment condition was subtracted from the percentage of cells with hox40L delivery under the treatment condition. of fososome. The percentage of cells with fusosome-mediated hox40L delivery was 32.2% (Figure 23), which demonstrated fusosome-mediated in vitro delivery of a membrane protein.
[001757] [001757] Fusosomes of HEK-293T cells expressing the glycoprotein G of the vesicular stomatitis virus (VSV-G) envelope on the cell surface and expressing the Cre recombinase protein were generated according to the standard ultracentrifugation procedure through a Ficoll gradient to obtain small particle fusosomes, as described here in. To measure the ability of fusosomes to carry glucose across the cell membrane, levels of a 2-NBDG (2- (N- (7-nitrobenz-2-0xa-1,3-diazol-4-yl) Amino) - 2 -deoxyglucose) fluorescent analog glucose, which can be used to monitor glucose absorption in living cells, has been quantified to assess active transport through the lipid bilayer. A commercially available kit from Biovision Inc. (Catalog No. K682) was used for the assay according to the manufacturer's instructions.
[001758] [001758] Briefly, the fusosome sample was measured for total protein content by the bicinconinic acid test (BCA, ThermoFisher, Catalog No. 23225) according to the manufacturer's instructions. Next, 40 µg of total fusosome protein was granulated by centrifugation at 3000 g for 5 minutes in a table centrifuge, followed by resuspension in 400 µl of DMEM supplemented with 0.5% fetal bovine serum. This was done in duplicate for each sample, and one of the duplicates was treated with 4 μl of chloretine (supplied with the Kit), a natural phenol that inhibits glucose uptake, as a control of glucose uptake inhibition. The samples were then incubated for 1 hour at room temperature. After incubation, the fusosome sample was granulated and resuspended in 400 μl of glucose uptake mix prepared previously (see Table A below for formulation). The samples pretreated with chloride
[001759] [001759] The samples were then incubated at 37ºC with 5% CO> for 30 minutes. After the incubation cells have been granulated, washed once with 1ml of 1X Analysis Buffer (supplied with the kit), granulated again and resuspended in 400ul of 1X Analysis Buffer.
[001760] [001760] The samples were then measured to capture 2- NBDG by flow cytometry analysis using an Invitrogen Attune NxT acoustic focusing cytometer. The 2-NBDG was excited with a 488 nm laser and the emission captured at 513 +/- 26 nm. The direct and lateral dispersion ports were initially used to capture events of the size of a fussoma and discard small debris. The positive events for the 2-NBDG were determined by blocking at the minimum level for which the negative control sample of the 2-NBDG showed <0.5% of the positive events for the 2-NBDG staining. The blocked cells positive for 2-NBDG fluorescence were then evaluated for mean fluorescence intensity (FI) of 2-NBDG in order to calculate a value for glucose uptake for fusosomes with and without chloretine treatment. .
[001761] [001761] With this assay, the fusosome derived from a HEK-293T cell expressing VSV-G and Cre showed an average IF of 2 NBDG of 631.0 +/- 1.4 without fluoretine treatment and an average IF of 565.5 +/- 4.9 with treatment with chloretine (Figure 24). EXAMPLE 127: MEASURING STERASE ACTIVITY IN THE CYTO- SUN
[001762] [001762] C2C12 cell fusosomes were generated according to the standard ultracentrifugation procedure using a Ficoll gradient to obtain small particle fusosomes, as described here. To measure esterase activity in the cytosol of fusosomes, samples were stained with Calcein AM (BD Pharmigen, Catalog No. 564061), a fluorescein derivative and vital non-fluorescent dye that passively passes through the cell membrane of viable cells and is converted by cytosolic esterases into green fluorescent calcein, which is retained by cells with intact membranes and inactive protein resistant to multiple drugs.
[001763] [001763] Briefly, the fusosome sample was measured for total protein content by the bicinconinic acid test (BCA, ThermofFisher, Catalog No. 23225) according to the manufacturer's instructions. Then, 20 µg of total fusosome protein was granulated by centrifugation at 3,000 g for 5 minutes in a table centrifuge, followed by resuspension in 400 µl of DMEM supplemented with 0.5% fetal bovine serum. The membrane-permeable dye, calcein-AM, was prepared as a 10 mM stock solution in dimethylsulfoxide and as a 1 mM working solution in PBS buffer, pH 7.4. VSV-G fusosomes were stained with 1 UM solution of calcein-AM diluted in DMEM medium. The samples were incubated at 37ºC in the dark for 30 minutes and then granulated by centrifugation. After washing twice with buffer
[001764] [001764] Samples were measured for retention of calcein fluorescence using an Invitrogen Attention NxT acoustic focusing cytometer. Calcein AM was excited with a 488 nm laser and captured emission at 513 +/- 26 nm. The front and side dispersion ports were initially used to capture fusosome-sized events and discard small debris. Positive events for calcein were determined by blocking the minimum level to which the negative control sample of calcein showed <0.5% of positive events for staining with calcein. The blocked cells positive for calcein fluorescence were then evaluated for the mean fluoresceence intensity (IF) of calcein in order to calculate a value for the activity of esterase in the cytosol of the fusosomes.
[001765] [001765] With this assay, the fusosome derived from a C2C12 cell showed an esterase activity (mean FI calcein) of 631.0 +/- 1.4 (Figure 25). EXAMPLE 128: MEASUREMENT OF ACETYL CHOLINESE ACTIVITY RASE IN FUSOSOMES
[001766] [001766] HEK-293T cell fusosomes expressing the syncytin-1 placenta cell-cell fusion protein (Syn1) on the cell surface and expressing the Cre recombinase protein were generated as described herein. Acetylcholinesterase activity was measured using the FluoroCet Quantification Kit (System Biosciences, Catalog No. FCET96A-1), following the manufacturer's recommendations.
[001767] [001767] Briefly, the fusosomes were granulated by ultracentrifugation at 120,000 g for 90 minutes and carefully resuspended in phosphate buffered saline (PBS). The following spindles were quantified in terms of total protein content by assay with bicinchoninic acid (BCA, ThermoFisher, Cat.
[001768] [001768] In duplicate wells of a 96-well titration plate, 50 µl of lysed fusosome sample was mixed with 50 µl of buffer A working material and 50 µl of buffer B working material. In parallel, a standard curve was prepared by pipetting 2 µl of the supplied standard into 126 µl of 1X reaction buffer. This standard solution was then diluted in a 5X series to make a six point standard curve consisting of exosome equivalents 2.0E + 08, 1.0E + 08, 5.0E + 07, 2.5E + 07, 1.25E + 07 and 6.25E + 06 of acetylcholinesterase activity. 50 μl of each standard was then mixed with 50 μl of working material from buffer A and 50 μl of working material from buffer B in duplicate wells of the 96-well titration plate. 50 µl of 1X reaction buffer was used as a blank. The plate was mixed by tapping the sides and incubated in the dark for 20 minutes at room temperature. The plate was then measured immediately using a fluorescence plate reader set at Exception: 530 at 570 nm and Emission: 590 at 600 nm. The plate was shaken for 30 seconds before reading.
[001769] [001769] The relative fluorescence units (RFU) were then plotted against the known exosome equivalents of acetylcholinesterase activity after subtracting the RFU values from the blank wells. A linear regression line was then calculated and the equation used to determine acetylcholinesterase activity (in exosome equivalents) for the fusosome samples from the measured RFU values. The acetylcholinesterase activity measured for Syn1 fusosomes is shown in Table B: TABLE B: ACETYL CHOLINESTERASE ACTIVITY IN SPINDLES-
[001770] [001770] Fusosomes of HEK-293T cells that express the G-glycoprotein of the vesicular stomatitis virus (VSV-G) envelope on the cell surface and that express the Cre recombinase protein were generated as described herein. To determine the level of metabolic activity of the fusosome preparation, citrate synthase activity was assessed using a commercially available kit from Sigma (Catalog No. CS0720) that provides all necessary reagents. The citrate synthase is an enzyme in the tricarboxylic acid cycle (TCA) that catalyzes the reaction between oxaloacetate (OAA) and acetyl-CoA to generate citrate. After the hydrolysis of acetyl-CoA, there is a release of CoA with a thiol group (COA-SH). The thiol group reacts with a chemical reagent, 5,5-Dithiobis- (2-nitrobenzoic acid) (DTNB), to form 5-thio-2-nitrobenzoic acid (TNB), which has a yellow product that can be measured spectrophotometrically at 412 nm.
[001771] [001771] The test was carried out according to the manufacturer's recommendations. Briefly, the fusosome sample was measured for total protein content by assay with bicinchoninic acid (BCA, ThermoFisher, Catalog No. 23225) according to the manufacturer's instructions. Next, 400ug of total fusosome protein was granulated by centrifugation at 3,000g for 5 minutes in a table centrifuge. Fusosomes were washed once again by granulation and resuspended in ice-cold PBS. Fusosomes were again granulated and the supernatant was removed. The granule was smoothly
[001772] [001772] To start the citrate synthase activity test, all test solutions were warmed to room temperature before use. The lysed fusosome sample was mixed with test solutions according to Table C below: TABLE C: REACTION SCHEME FOR MEASURING ACTIVITY OF CITRATE SYNTHASE IN 96-well TITRATION PLATE 30mM Buffer Solution | Solution 10mM OAA Solution [To iemmas (slabs. Lone ton | naconsáo param |
[001773] [001773] The volumes in Table C represent volumes for a single well of a 96-well titration plate. The samples were measured in duplicate. All components of the reaction were mixed and pipetted into a single well on a 96-well titration plate. The absorbance at 412 nm was then analyzed in a microplate reader for 1.5 minutes to measure the baseline reaction. Then, 10 µl of the 10 MM OAA solution was added to each well to initiate the reaction. The plate was shaken for 10 seconds in the microplate reader before reading the absorbance at 412 nm for 1.5 minutes with a measurement every 10 seconds.
[001774] [001774] To calculate the activity of citrate synthase, the absorbance at 412nm was plotted against time for each reaction. The change in absorbance per minute was calculated for the linear range of the graph for addition of OAA before (endogenous activity) and after (total activity). The net activity of citrate synthase was then calculated by subtracting the activity
[001775] [001775] Fusosomes of HEK-293T cells that express the G-glycoprotein of the vesicular stomatitis virus (VSV-G) envelope on the cell surface were generated according to the standard ultracentrifugation procedure using a Ficoll gradient to obtain small particle fusosomes, as described herein. The level of respiration in the preparation of the fusosome was determined by measuring the rates of mitochondrial oxygen consumption by an extracellular flow analyzer Seahorse (Agilent).
[001776] [001776] Briefly, the fusosome sample was measured for total protein content by the bicinconinic acid test (BCA, ThermofFisher, Catalog No. 23225) according to the manufacturer's instructions. Then, 20 µg of total fusosome protein was granulated by centrifugation at 3000g for 5 minutes in a table centrifuge, followed by resuspension (in quadruplicates) in 150 µl of XF assay medium (Agilent Catalog No. 103575-100 ) supplemented with 25 mM glucose and 2 mM glutamine (pH 7.4). The resuspended samples were then added to a well on a 96-well Seahorse plate (Agilent).
[001777] [001777] The oxygen consumption tests were started by incubating the 96-well Seahorse plate with samples at 37ºC for 60 minutes to allow the temperature and pH to reach equilibrium. The microplate was then analyzed on the XF96 extracellular flow analyzer (Agilent) to measure changes in extracellular flow of oxygen and pH in the media immediately around the fusosomes. After obtaining steady-state oxygen consumption and extracellular acidification rates, oligomycin (5 µM), which inhibits ATP synthase, and the ionophor proton FCCP (carbonyl cyanide 4- (trifluoromethoxy) phenylhydrazone; 2 uM), which decouples mitochondria, were injected sequentially through reagent distribution chambers to each well in the microplate to obtain values for maximum oxygen consumption rates. Finally, 5 µM of antimycin A (inhibitor of the mitochondrial complex 111) was injected to confirm that the respiratory changes were mainly due to mitochondrial breathing. Antimycin A respiration rates were subtracted from the other three respiration rates in order to determine baseline, uncoupled (oligomycin-resistant) and maximum (FCCP-induced) respiration rates.
[001778] [001778] Using this assay, it was determined that donor VSV-G fusosomes had baseline, decoupled rates and maximum oxygen consumption (respiration) according to Table D below. TABLE D: FUSOSOMES BREATHING RATES VSV-G piration (pmol / min / 20ug of fusosome) AVG + WITHOUT EXAMPLE 131: MEASUREMENT OF PHOSPHATIDYLSERINE LEVELS OF FUSOSOMES
[001779] [001779] Fusosomes of HEK-293T cells that express the G-glycoprotein of the vesicular stomatitis virus (VSV-G) envelope on the cell surface and that express the Cre recombinase protein were generated according to the standard ultracentrifugation procedure through a Ficoll gradient to obtain small particle fusosomes, as described here. To measure phosphatidyl serine levels of fusosomes, annexin V staining was performed using a commercially available annexin V conjugated with Alexa Fluor 647 dye (Catalog No. A23204) according to the manufacturer's instructions. Annexin V is a cellular protein that can bind to phosphatidylserine when exposed to the outer leaflet of the plasma membrane; thus, reading the attachment of annexin V to a sample can provide an assessment of the levels of phosphatidylserine in the sample.
[001780] [001780] Briefly, the fusosome sample was measured for total protein content by the bicinconinic acid assay (BCA, ThermofFisher, Catalog No. 23225) according to the manufacturer's instructions. Then, 40 µg of total fusosome protein was granulated by centrifugation (in triplicates of the sample) at 3,000g per minute in a table centrifuge, followed by resuspension in 400ul of DMEM supplemented with 2% fetal bovine serum. One sample was treated with 40 µM of antimycin A. The samples were then incubated for 1 hour at 37ºC. After incubation the samples were then granulated by centrifugation again and resuspended in 100 µl of annexin binding buffer (ABB; 10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4). Then 5 µl of annexin V conjugated to Alexa Fluor 647 were added to each sample (except for the negative control without annexin V staining). The samples were incubated for 15 minutes at room temperature, followed by the addition of 400 μl of ABB.
[001781] [001781] The samples were then measured for annexin V staining by flow cytometry analysis using an Invitrogen Attune NxT acoustic focusing cytometer. Annexin V conjugated to Alexa Fluor 647 was excited with a 638 nm laser and the emission captured at 670 +/- 14 nm. The front and side dispersion ports were initially used to capture fusosome-sized events and discard small debris. The positive events for staining with Alexa Fluor 647 (annexin V) were determined by closing at the minimum level for which the negative control sample with unstained annexin V showed <0.5% of the positive events for staining with Alexa Fluor 647. Blocked positive events for staining with Alexa Fluor 647 were then assessed for the percentage of positive events in annexin V of the total population of parents (fusosome-size events in the forward / side) and this value was used to quantify the levels of phosphatidylserine in the fusosome sample.
[001782] [001782] With this assay, the fusosome derived from a HEK-293T cell expressing VSV-G and Cre showed a% of fusosomes positive for annexin V of 63.3 +/- 2.3% without anti-mycine treatment A and a percentage of positive annexin V fusosomes of 67.6 +/- 5.7% with antimycin treatment A. EXAMPLE 132: MEASURING THE AVERAGE POTENTIAL OF THE MEMBRANE MITOCHONDRIAL
[001783] [001783] Fusosomes of HEK-293T cells expressing the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface and expressing the Cre recombinase protein were generated according to the standard ultracentrifugation procedure through a Ficoll gradient to obtain small particle fusosomes, as described here in. To measure mean mitochondrial membrane potential levels of fusosomes, a commercially available dye that is sensitive to the potential of mythondrial membrane, tetramethylrodamine, ethyl ester, perchlorate (TMRE; Abcam, Catalog No. T669) was used to evaluate the potential of mitochondrial membrane. To normalize the fluorescence intensity of the TMRE (FI) with the amount of mitochondria in the sample, the dye MitoTracker Green FM (MTG; ThermoFisher, catalog number M7514) was used to co-color the samples in order to normalize the TMRE FI for MTG FI and thus the amount of mitochondria in the sample. In addition, carbonyl-p-trifluoromethoxyphenyl hydrazone cyanide (FCCP; Sigma catalog number C2920) was used to treat a parallel set of samples in order to completely depolarize the mitochondrial membrane potential and thus allow quantification of the potential of the mitochondrial membrane in millivolts based on the decrease in TMRE Fl.
[001784] [001784] Briefly, the fusosome sample was measured for total protein content by the bicinconinic acid assay (BCA, ThermofFisher, Catalog No. 23225) according to the manufacturer's instructions. Then, 40 ug of total fusosome protein was granulated by centrifugation (in quadruplicates of the sample for untreated and FCCP-treated duplicates) at 3,000 g for 5 minutes in a table centrifuge, followed by resuspension in 100ul of supplemented DMEM with 2% fetal bovine serum and containing TMRE and MTG dyes in a final concentration of 30 nM and 200 nM, respectively. A parallel set of fusosome samples was left unstained as a negative control. The samples were incubated for 45 minutes at 37ºC. After incubation, the samples were granulated by centrifugation and resuspended in 400 µl of DMEM medium of phenol without red containing 30 nm of TMRE. A set of duplicates was treated with 20 µM of FCCP for 5 minutes before evaluation by flow cytometry.
[001785] [001785] The samples were then measured for annexin V staining by flow cytometry analysis using an Invitrogen Attune NxT acoustic focusing cytometer. MTG was excited with a 488 nm laser and the emission captured at 530 +/- 30 nm. The TMRE was excited with a 561 nm laser and the emission captured at 585 +/- 16 nm. The front and side dispersion ports were initially used to capture fusosome-sized events and discard small debris. The positive events for MTG and TMRE staining were determined by blocking the minimum level for which the untainted control sample showed <0.5% of the positive events for MTG or TMRE staining. The positive blocked events for MTG and TMRE staining were then evaluated for the mean IF of MTG and TMRE.
[001786] [001786] Potential membrane values (in millivolts, mV) are calculated based on the intensity of the TMRE after the normalization of the values of TMRE FI to MTG Fl. This value of the TMRE / MTG ratio allows normalizing the intensity of the TMRE with the amount of mitochondria in the sample. The value of the TMRE / MTG ratio for samples not treated and treated with FCCP is calculated and used to determine the membrane potential in millivolts using a modified Nernst equation (see below) that can determine the potential of the mitochondrial membrane based on in the fluorescence of TMRE (as TMRE accumulates in mitochondria in a Nernstian way). The potential of the fusosome membrane is calculated with the following formula: (mV) = -61.5 * log (Fl (untreated) / Fl (treated with FCCP)). Using this equation, the calculated mitochondrial membrane potential of the VSV-G fusosome sample was -29.6 +/- 1.5 millivolts. EXAMPLE 133: MEASURING PERSISTENCE HALF-LIFE IN A SUBJECT
[001787] [001787] This example describes the measurement of the fusosome half-life. Fusosomes were subjected to acute transfection for 2 hours before preparation; they were derived using methods described herein and loaded with firefly luciferase mRNA.
[001788] [001788] After preparation, the fusosomes were granulated by centrifugation and the fusosome particles were resuspended in sterile phosphate buffered saline for injection. A buffered solution without fusosomes was used as a negative control.
[001789] [001789] Fusosomes were delivered to 9-week-old FVB mice (Jackson Laboratory, 001800) via intramuscular (IM) administration in the anterior tibal. The solution was handled in such a way as to guarantee the continuous sterility of the content. Anesthesia was performed in an induction chamber (—- 4% isoflurane, to be effective) and maintained via the nasal cone (- 2% isoflurane, to be effective) with animals placed on a heated operating table (35ºC). The skin over the middle belly of the anterior tibial muscle (TA) was prepared by removing the area (Nair Hair Remover cream for 45 seconds, followed by cleaning the area with 70% ethanol). Using a tuberculin syringe, 50 µl of fusosome solution 15 µg protein / µl, medium (SEM)) were injected intramuscularly into the TA's belly. After the injection was completed, the syringe was removed and pressure was applied to the injection site. The contralateral leg was treated with PBS using the same method as a control.
[001790] [001790] After delivery, the luciferase mRNA is translated into the receptor cytoplasm into luciferase protein. Intraperitoneal (IP) administration of D-luciferin (Perkin Elmer, 150 mg / kg) allowed the detection of luciferase expression via bioluminescent imaging in vivo. The animal was placed in a bioluminescent imaging chamber in vivo (Perkin Elmer) that houses a cone anesthetist (isoflurane) to prevent movement of the animal. Photon collection was performed between 3 and 35 minutes after injection to observe the maximum bioluminescent signal due to the pharmacokinetic clearance of D-luciferin. The maximum radiation was recorded in photons / s / cm2 / radians. The total flow, which integrates the area's splendor, was quantified using a region of interest (ROI) tool within the Living Image Software (Perkin Elmer) and reported in photons / s. Anterior tibial muscle tissues treated with fusosome and treated with PBS were monitored specifically for luminosity measurements in comparison
[001791] [001791] Evidence of the presence of firefly luciferase was detected by a bioluminescent image in the animal's receptor tissue, as shown in Figures 26A to 26B. EXAMPLE 134: MEASURING THE DIRECTION POTENTIAL IN A SUBJECT (BIVS-CRE GESICLES)
[001792] [001792] This example assesses the ability of a fusosome to reach a specific location in the body. Fusosomes were derived using methods as described herein and were loaded with cre-recombinase protein.
[001793] [001793] Two doses of fusosomes (1x and 3x) were delivered to the Loxp Luciferase (Jackson Laboratory, 005125), the mice were injected intravenously (IV) via the tail vein. The mice were placed under a heat lamp (using a 250 W heat lamp (infrared)) for - 5 minutes (or until the mice started to excessively comb the bugs) to dilate the tail vein . The mice were placed in a limiter and the tail was cleaned with 70% ethanol to better visualize the vein.
[001794] [001794] Using a tuberculin syringe, 200 µl of fusosome solution 1x (8.5e8 +/- 1.4e8 particles / ul, mean (SEM)) or 3x (2.55e9 +/- 1.4e8 / ul particles) was injected , mean (SEM)) IV. After the injection was completed, the syringe was removed and pressure was applied to the injection site.
[001795] [001795] After the fusion, the CRE protein was translocated to the nucleus to perform recombination, which resulted in the constitutive expression of luciferase. Three days after the treatment, the subjects' ventral region was prepared by shaving the area (Nair Hair Remover cream for 45 seconds, followed by cleaning the area with 70% ethanol). The subjects were then treated with D-luciferin (Perkin Elmer, 150 mg / kg) by intraperitoneal administration. This allowed the detection of luciferase expression through in vivo bioluminescent images. The animal was placed in an in vivo bioluminescent imaging chamber (Perkin Elmer) that houses a cone anesthetist (isoflurane) to prevent the animal from moving. Photon collection was performed between 3 and 15 minutes after injection to observe the maximum bioluminescent signal due to the pharmacokinetic clearance of D-luciferin. The maximum radiation was recorded in photons / s / cm2 / radians. The total flow, which integrates the area's splendor, was quantified using a region of interest (ROI) tool within the Living Image Software (Perkin Elmer) and reported in photons / s.
[001796] [001796] Evidence of protein delivery (Cre recombinase) by fusosomes was detected by bioluminescent imaging in the animal's recipient tissue, as shown in Figures 27A to 27B. The signal was observed mainly in the spleen and liver, with the 3x group showing the highest signal.
[001797] [001797] After the image of the entire body, the mice were displaced cervically and the liver, heart, lungs, kidney, small intestine, pancreas and spleen were collected and photographed within 5 minutes after euthanasia. Evidence of protein delivery (Cre recombinase) to the liver and spleen by fusosomes was detected by a bioluminescent image in the recipient tissue extracted from the animals. This can be seen in Figures 28A to 28B. The signal was highest in the spleen and the lowest in the heart, with the 3x group showing the highest signal (p = 0.0004 compared to the heart). EXAMPLE 135: DELIVERY OF FUSOSOMES BY AN INDEPENDENT WAY PENDING ON ACIDIFICATION OF LYSOSOMES
[001798] [001798] Often, the entry of complex biological charge in target cells is carried out by endocytosis. Endocytosis requires the charge to enter an endosome, which matures into an acidified lysosome. Disadvantage, the charge that enters the cell through endocytosis can become trapped in an endosome or lysosome and be unable to reach the cytoplasm. The cargo can also be damaged by acidic conditions in the lysosome. Some viruses are capable of non-endocytic entry into target cells; however, this process is completely incomplete. This example demonstrates that a viral fusogen can be isolated from the rest of the virus and gives non-endocytic entry to a fusosome that lacks other viral proteins.
[001799] [001799] Fusosomes of HEK-293T cells expressing the Nipah virus receptor binding protein G and the fusion protein F (NivG + F) on the cell surface and expressing the recombinase Cre protein were generated according to the standard ultracen procedure - trifugation using a Ficoll gradient to obtain small particle fumosomes, as described here. To demonstrate delivery of the fusosome to a recipient cell via a non-medical route, NivG + F fusosomes were used to treat recipient HEK-293T cells modified to express a "loxP-GFP-stop loxP-RFP" cassette under CMV Promoter. The NivF protein is a pH-independent envelope glycoprotein that has been shown not to require environmental acidification for activation and subsequent fusion activity (Tamin, 2002).
[001800] [001800] The recipient cells were plated 30,000 cells / well in a 96-well black plate with a light background. Four to six hours after the plating of the recipient cells, the NivG + F fusosomes that express the Cre recombinase protein were applied to the target or non-target recipient cells in the DMEM media. The fusosome sample was first measured for total protein content by the bicinconinic acid test (BCA, ThermoFisher, Catalog No. 23225) according to the manufacturer's instructions. Receptor cells were treated with 10 µg of fusosomes and incubated for 24 hours at 37ºC and CO; to 5%. To demonstrate that the delivery of Cre via NivG + F cells was via a non-endocytic route, a parallel well of recipient cells that received treatment with NivG + F spindle cells was co-treated with an endosomal / lysosome acidification inhibitor , bafilomycin A1 (Baf; 100 nM; Sigma, Catalog No. B1793).
[001801] [001801] Cell plates were photographed using an automated microscope (www.biotek.com/products/imaging-microscopy- automated-cell-Imagers / lionheart-fx-automated-live-cell-Iimager /). The total population of cells in a given well was determined by staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains cell nuclei by interleaving with DNA and, therefore, was used to identify individual cells. The Hoechst coloring was photographed using the LED and DAP filter cube! 405 nm. The GFP was created using the 465 nm LED and GFP filter cube, while the RFP was created using the 523 nm LED and RFP filter cube. Images of wells of target and non-target cells were acquired by first establishing the LED intensity and integration times in a positive control well containing adenovirus-treated recipient cells encoding Cre recombinase instead of fusosomes.
[001802] [001802] The acquisition settings were defined so that the Hoescht, RFP and GFP intensities would reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, with automatic focus on the Hoescht channel and then using the focal plane established for the GFP and RFP channels. The analysis of cells positive for GFP and RFP was performed with the Gen5S software provided with an automatic fluorescent microscope (https://www.biotek.com/products/software-robotics-software/gen5- microplate-reader-and-imager -software /).
[001803] [001803] The images were pre-processed using a rolling ball background subtraction algorithm with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells that receive Cre) was then divided by the sum of the positive cells for GFP (recipient cells that did not deliver) and positive cells for RFP to quantify the conversion percentage of RFP, which indicates the fused fusion quantity with the recipient cells.
[001804] [001804] With this assay, the fusosome derived from a HEK-293T cell that expresses NivG + F on its surface and contains the recombinase Cre protein showed significant delivery via an independent lysosome pathway, which is consistent with entry via a non-endocytic pathway, as evidenced by a significant delivery of Cre charge by NivG + F fusosomes, even when the receptor cells were co-treated with Baf to inhibit endocytosis-mediated uptake (Figure 29). In this case, the inhibition of load delivery by co-treatment with Baf was 23.4%. EXAMPLE 136: DELIVERY OF FUSOSOMES THROUGH A WAY THAT INVOLVES LISOSOMIC ACIDIFICATION
[001805] [001805] Fusosomes of HEK-293T cells expressing the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface and expressing the Cre recombinase protein were generated by the standard ultracentrifugation procedure through a Ficoll gradient to get small particle fusosomes,
[001806] [001806] Cell plates were photographed using an automated microscope (www.biotek.com/products/imaging-microscopy- automated-cell-imagers / lionheart-fx-automated-live-cell-Iimager /). The total population of cells in a given well was determined by staining the cells with Hoechst 33342 in DMEM medium for 10 minutes. Hoechst 33342 stains the cell nuclei by interleaving in the DNA and, therefore, was used to identify individual cells. The Hoechst coloring was photographed using the LED and DAP filter cube! 405 nm. The GFP was photographed using the LED filter cube and
[001807] [001807] The acquisition settings were defined so that the Hoescht, RFP and GFP intensities reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, with automatic focus on the Hoescht channel and then using the focal plane established for the GFP and RFP channels. The analysis of positive cells for GFP and RFP was performed with the Gen5 software, supplied with an automatic fluorescent microscope (see www.biotek.com/products/software-robotics-software/gen5 -microplate- reader-and-imager-software /).
[001808] [001808] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells that receive Cre) was then divided by the sum of the positive cells for GFP (recipient cells that did not deliver) and positive cells for RFP to quantify the conversion percentage of RFP, which describes the amount of fusible fusion with recipient cells.
[001809] [001809] With this assay, the fusosome derived from a HEK-293T cell expressing VSV-G on its surface and containing Cre recombinase protein showed significant delivery via an endo-
[001810] [001810] Fusosomes were generated comprising a HeLa cell expressing the syncytin-1 placenta cell-cell fusion protein (Syn1) on the cell surface and expressing the fluorescent protein DsSsRED with mitochondrial target (mMtDsRED). The recipient cell was a HeLa Rho0 cell, which had been produced lacking mitochondrial DNA (mtDNA) by long-term culture (> 6 weeks) of HeLa cells in zalcitabine, a nucleoside-like reverse transcriptase inhibitor. Hela Rho0O cells are deficient in mMtDNA (as assessed by qPCR) and show significantly deficient mitochondrial oxygen consumption (as measured by the Seahorse extracellular flow test). HeLa Rho0 receptor cells were also modified to express the mitochondrial target GFP (mMtGFP) via adenoviral transduction for 2 days.
[001811] [001811] HeLa Rho0 receptor cells were placed in 6-well plates and one hour later, Syn1 HeLa cell fusosomes were applied to the recipient cells. The cells were then incubated for 24 hours at 37ºC and CO; to 5%. The cells were then classified into doubly positive (fused) cells by fluorescence-assisted cell screening using a BD FACS Aria SORP cell classifier. The population of doubly positive cells for mtGFP and mtDsRED was evaluated to classify recipient Hela Rho0O cells that received mitochondrial donation (mtDs-RED) from the syn1 HeLa cell fusosomes. MtGFP was excited with a 488hm laser and the emission captured at 513 +/- 26Nm. The mMtDsRED was excited with a 543nm laser and the emission captured at 570 +/- 26hm. The front and side scatter ports were initially used to capture cell-sized events and discard small debris. The doubly positive events for mtGFP and mtDsRED were determined by blocking at the minimum level for which each suitably negative control sample showed less than 1% of positive events for the specific fluorescent marker (ie, unblotted and single samples of mtGFP positive show less than 1% of positive events for mtDsRED). The doubly positive events, as well as the single positive mtGFP events (recipient cells without fusosome delivery) and single positive mtDsRED (donor fusosomes that did not fuse to the recipient cells) were then classified on DMEM media with 10% FBS and antibiotics. The classified cells were counted and sown in
[001812] [001812] Oxygen consumption tests were initiated by removing the growth medium, replacing it with a minimal medium of DMEM with low buffer containing 25bmM glucose and 2mM glutamine (Agilent) and incubating at 37ºC for 60 minutes to allow temperature and pH to reach equilibrium. The microplate was then analyzed in the XF96 extracellular flow analyzer (Agilent) to measure changes in extracellular flow of oxygen and pH in the medium immediately surrounding the adherent cells. After obtaining steady state oxygen consumption and extracellular acidification rates, oligomycin (5 µM), which inhibits ATP synthase, and the proton ionophore FCCP (carbonyl cyanide 4- (trifluoromethoxy) phenylhydrazone; 2 µM) , which decouples mitochondria, were injected sequentially through reagent distribution chambers for each cell in the micro-
[001813] [001813] Using this assay, it was determined that donor Syn1 HeLa cells had active rates of basal and maximal oxygen consumption, while recipient cells without spindle-sum delivery showed low rates in the three states of mitochondrial consumption of oxygen. Delivery of mitochondria with Syn1 HeLa cell fusosomes to recipient HeLa Rho0 cells showed a return to mitochondrial oxygen consumption rates close to donor Syn1 HeLa cell rates (Figure 31). EXAMPLE 138: IN VITRO DELIVERY OF DNA
[001814] [001814] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface, as described here. The control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. The charge was then loaded onto VSV-G fusosomes by ultrasound, as described in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016). In this experiment, the nucleic acid charge was DNA encoding the plasmid bacteriophage P1 Cre recombinase with an SV40 nuclear localization signal (ThermoFisher). DNA loaded fusosomes were then used to treat and show payload delivery to recipient HEK-293T cells designed to express a "LoxP-GFP-stop-LoxP-RFP" ribbon under the control of the CMV promoter.
[001815] [001815] Briefly, approximately 40º fusosomes or partial control particles (non-fusogenic fusosomes) corresponding to 80 µg of a standard VSV-G fusosome preparation were mixed with 140 µg of DNA and incubated at room temperature. for 30 minutes. The fusosome (or control particle) / nucleic acid mixture was then sonicated for 30 seconds at room temperature using a water bath sonicator (model Branson * 1510R-DTH) operated at 40 kHz. The mixture was then placed on ice for one minute, followed by a second round of sonication at 40 kHz for 30 seconds. The mixture was then centrifuged at 16,000 g per minute at 4 ° C to granulate fusosomes containing nucleic acid. The supernatant containing unincorporated nucleic acid was removed and the granule was resuspended in 30 µl of phosphate buffered saline. After loading the DNA, the loaded fusosome / control particles were kept on ice before use.
[001816] [001816] HEK-293T receptor cells designed to express a "LoxP-GFP-stop-LoxP-RFP" cassette were plated
[001817] [001817] The acquisition settings were defined so that the intensities of RFP, GFP and RFP reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the GFP and RFP channels. The analysis of the positive cells for RFP was performed with the Gen5 software provided with an automatic fluorescent microscope (https://www.biotek.com/products/ software-robotics-software / genS5-microplate-reader-and-imager- software /).
[001818] [001818] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells that receive Cre DNA) was then divided by the sum of the positive cells for GFP (total receptor cells) to quantify the percentage of cells that received Cre DNA delivery, which describes the amount of recipient cells that receive Cre DNA charge that was loaded into the fusosomes by sonication.
[001819] [001819] With this assay, the fusosome loaded with Cre DNA showed an observable level of Cre DNA delivery corresponding to 10.7 +/- 3.3% of positive RFP cells out of the total GFP positive receptor cells ( Figure 32). Untreated recipient cells or cells treated only with a fusosome or control particles loaded with DNA did not show appreciable RFP positive cells. EXAMPLE 139: IN VITRO DELIVERY OF MRNA
[001820] [001820] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface, as described here. The control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. The charge was then loaded onto VSV-G fusosomes by ultrasound, as described in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016). In this experiment, the nucleic acid charge was from an in vitro transcript, messenger RNA encoding bacteriophage P1 Cre recombininase with an SV40 nuclear localization signal (TriLink, catalog number L-7211). MRNA-loaded fusosomes were then used to treat and show payload delivery to recipient HEK-293T cells designed to express a "LoxP-GFP-stop-LoxP-RFP" ribbon under the control of the CMV promoter.
[001821] [001821] Briefly, approximately 10th fusosomes or part control particles (non-fusogenic fusosomes) corresponding to 20 ul of a standard VSV-G fusosome preparation were mixed with 10 µg of mRNA and incubated at room temperature for 30 minutes . The fusosome (or control particle) / nucleic acid mixture was then sonicated for 30 seconds at room temperature using a water bath sonicator (Brason model 1510R-DTH) operated at 40 kHz. The mixture was then placed on ice for one minute, followed by a second round of sonication at 40 kHz for 30 seconds. The mixture was then centrifuged at 16,000 g per minute at 4 ° C to granulate fusosomes containing nucleic acid. The supernatant containing unincorporated nucleic acid was removed and the granule was resuspended in 30 µl of phosphate buffered saline. After loading the mMRNA, the loaded spindle / control particles were kept on ice before use.
[001822] [001822] HEK-293T receptor cells designed to express a "LoxP-GFP-stop-LoxP-RFP" cassette were plated
[001823] [001823] The acquisition settings were defined so that the RFP, GFP and RFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the GFP and RFP channels. The analysis of the positive cells for RFP was performed with the Gen5 software provided with an automatic fluorescent microscope (https: // www.biotek.com/ products / software-robotics-software / genS5-microplate- reader-and-imager-software /) .
[001824] [001824] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells that receive Cre mMRNA) was then divided by the sum of GFP positive cells (total recipient cells) to quantify the percentage of cells that received delivery of Cre MRNA, which describes the number of receiving cells that receive Cre MRNA payload that was loaded into the fusosomes by sonication.
[001825] [001825] With this assay, the fusosome loaded with Cre mRNA showed an observable level of Cre MRNA delivery corresponding to 52.8 +/- 7.8% RFP positive cells of the total cell
[001826] [001826] This example describes the delivery of messenger RNA (MRNA) to cells in vivo via fusosomes. The delivery of mRNA to cells in vivo resulted in the expression of proteins within the receptor cell. This delivery method was used to introduce a non-present protein, which would allow cleavage of the loxp sites and the subsequent expression of a non-endogenous molecule. Fusosomes were subjected to acute transfection for 2 hours before preparation; they were derived using methods as described here and were loaded with firefly luciferase mRNA.
[001827] [001827] After preparation, the fusosomes were granulated by centrifugation and the fusosome particles were resuspended in sterile phosphate-buffered saline for injection. A buffered solution without fusosomes was used as a negative control.
[001828] [001828] Fusosomes were delivered to 9-week-old FVB mice (Jackson Laboratory, 001800), via intramuscular (IM) administration in the anterior tibal. The solution was handled in such a way as to ensure continuous sterility of the content. Anesthesia was performed in an induction chamber (—- 4% isoflurane, to be effective) and maintained via the nasal cone (- 2% isoflurane, to be effective) with animals placed on a heated operating table (35ºC). The skin over the middle belly of the anterior tibial muscle (TA) was prepared by removing the area (Nair Hair Remover cream for 45 seconds, followed by cleaning the area with 70% ethanol). Using a tuberculin syringe, 50 µl of fusosome solution 15 µg protein / µl, medium (SEM)) were injected intramuscularly into the TA's belly. After the injection was completed, the syringe was removed and pressure was applied to the injection site. The contralateral leg was treated with PBS using the same method as a control.
[001829] [001829] After delivery, MRNA luciferase is translated into the receptor cytoplasm into luciferase protein. Intraperitoneal (IP) administration of D-luciferin (Perkin Elmer, 150 mg / kg) allowed the detection of luciferase expression via bioluminescent imaging in vivo. The animal was placed in a bioluminescent imaging chamber in vivo (Perkin Elmer) that houses a cone anesthetist (isoflurane) to prevent movement of the animal. Photon collection was performed between 3 to 35 minutes after injection to observe the maximum bioluminescent signal due to the pharmacokinetic clearance of D-luciferin. The maximum brightness is recorded in photons / s / cm2 / radians. The total flow, which integrates the splendor of the area, is quantified using a region of interest (ROI) tool within the Living Image Software (Perkin Elmer) and reported in photons / s. The anterior tibial muscle tissues treated with fusosome and treated with PBS were monitored specifically for measurements of luminosity in comparison with negative controls (negative control without thread (chest) and stage). Measurements were performed 1, 6, 12, 24 and 48 hours after injection to observe the presence of firefly luciferase.
[001830] [001830] Evidence of the presence of firefly luciferase was detected by a bioluminescent image in the animal's recipient tissue, as shown in FIGURES 15A to 15B. (A) Ventral image and luminescent signal of treated fusosome (right leg) versus treated PBS (left leg) of FVB mice. The left side is an overlap of image and luminescent signal and the right side is only luminescent signal. (B) total flow signal of AT treated with fusosome (dark square), AT treated with PBS (open circle), mouse background (dark hexagon) and stage background (open hexagon);
[001831] [001831] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface, as described here. The control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. The charge was then loaded onto VSV-G fusosomes by ultrasound, as described in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016). In this experiment, the load was a bacteriophage P1 Cre recombinase with a recombinant nuclear locating SV40 protein (NEB, Catalog No. MO298M). The protein-loaded fusosomes were then used to treat and show the payload delivery to recipient HEK-293T cells designed to express a "LoxP-GFP-stop-LoxP-RFP" tape under CMV promoter control. .
[001832] [001832] Briefly, approximately 10th fusosomes or part control particles (non-fusogenic fusosomes) corresponding to 20 ul of a standard VSV-G fusosome preparation were mixed with 5 ul of protein (NEB% MO0298M) and incubated at room temperature for 30 minutes. The fusosome (or control particle) / protein mixture was then sonicated for 30 seconds at room temperature using a water bath sonicator (model Brason tt 1510R-DTH) operated at 40 kHz. The mixture was then placed on ice for one minute, followed by a second round of sonication.
[001833] [001833] HEK-293T receptor cells designed to express a "LoxP-GFP-stop-LoxP-RFP" cassette were plated
[001834] [001834] The acquisition settings were defined so that the RFP, GFP and RFP intensities reach the maximum pixel intensity values, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the GFP and RFP channels. The analysis of the positive cells for RFP was performed with the Gen5 software provided with an automated fluorescent microscope (see www .biotek.com / products / software-robotics-software / genS5-microplate-reader-and-imager-software /).
[001835] [001835] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells that receive Cre protein) was then divided by the sum of GFP positive cells (total recipient cells) to quantify the% of cells that received Cre protein delivery, which describes the number of recipient cells that receive payload of Cre protein that was loaded into the fusosomes by sonication.
[001836] [001836] With this assay, Fusosomes loaded with Cre protein showed a statistically significant level of Cre protein delivery corresponding to 27.4 +/- 6.8% of positive RFP cells out of the total GFP positive recipient cells (Figure 35). Untreated recipient cells or cells treated only with spindle sum or control particles loaded with protein did not show appreciable RFP positive cells.
[001837] [001837] This example describes the delivery of therapeutic agents to the muscle by fusosomes. Fusosomes were derived using the methods described here and were loaded with the CRE-recombinase protein.
[001838] [001838] Fusosomes were delivered to Loxp Luciferase mice (Jackson Laboratory, 005125) via intramuscular administration (IM) in the anterior tibal. The solution was handled in such a way as to ensure the continuous sterility of the content. Anesthesia was induced in an induction chamber (—- 4% isoflurane, for effect) and maintained via the nasal cone (- 2% isoflurane, for effect) with animals placed on a heated operating table (35ºC). The skin over the middle belly of the anterior tibial muscle (TA) was prepared by shaving the area (Nair Hair Remover cream for 45 seconds, followed by cleaning the area with 70% ethanol). Using a tuberculin syringe, 50 ul of the fusosome solution (particles 8.5e8 +/- 1.4e8 / ul, mean (SEM)) were injected intramuscularly into the belly of the TA. After the completion of the injection, the syringe was removed and pressure was applied to the injection site. The contralateral leg was not treated.
[001839] [001839] After the fusion, the CRE protein was translocated to the nucleus to perform recombination, which resulted in the constitutive expression of luciferase. Intraperitoneal administration of D-luciferin (Perkin Elmer, 150 mg / kg) allowed the detection of luciferase expression by in vivo bioluminescent imaging. The animal was placed in a bioluminescent imaging chamber in vivo (Perkin Elmer) that houses a cone anesthetist (isoflurane) to prevent the animal from moving. Photon collection was performed between 3 and 35 minutes after injection to observe the maximum bioluminescent signal due to the pharmacokinetic clearance of D-luciferin. The maximum brightness is recorded in photons / sec / cm / Radians. The total flow, which integrates the splendor of the area, is quantified using a region of interest (ROI) tool within the Living Image Software (Perkin Elmer) and reported in photons / s. The tibial anterior muscle tissue treated with fusosomes was monitored specifically for radiation measurements in comparison with negative controls (negative control without thread (chest), contralateral posterior limb and stage). Measurements were taken on day 14 after injection to observe the presence of firefly luciferase.
[001840] [001840] Evidence of protein delivery (Cre recombinase) by fusosomes was detected by bioluminescent imaging in the animal's recipient tissue, as shown in Figures 36A to 36B. EXAMPLE 143: LOAD MEDIATED BY ACID SONICATION NUCLEIC IN FUSOSOMES
[001841] [001841] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells, expressing the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface and expressing the recombinase Cre protein , as described here. A nucleic acid charge was then loaded onto the VSV-G fusosomes by ultrasound, as described in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016). In this experiment, the nucleic acid payload was a DNA plasmid encoding the fluorescent protein miRFP670. The nucleoside-charged fusosomes were then used to treat and deliver payload to show recipient HEK-293T cells modified to express a "loxP-BFP-stop-loxP-Clover" cassette, with a CMV promoter.
[001842] [001842] Briefly, approximately 10th fusosomes corresponding to 50 µl of a standard VSV-G fusosome preparation were mixed with 10 µg of nucleic acid and incubated at room temperature.
[001843] [001843] HEK-293T receptor cells designed to express a "Loxp-BFP-stop-Loxp-Clover" cassette were plated
[001844] [001844] The acquisition settings were defined so that the intensities of BFP, Clover and miRFP670 reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the Clover and mMIRFP670 channels. The analysis of miRFP670 positive cells was performed with the Gen5 software provided with an automatic fluorescent microscope (see www.biotek.com/products/software-robotics-software/ genS5-microplate-reader-and-imager-software /).
[001845] [001845] The images were pre-processed using a rolling ball background subtraction algorithm with a width of 60 µm. Cells with BFP intensity significantly above background intensities were thresholded and areas too small or large to be BFP positive cells were excluded. The same analysis steps were applied to the Clover and miRFP670 channels. The number of miRFP670 positive cells (recipient cells that receive the miRFP670 DNA plasmid) was then divided by the sum of the BFP positive cells (total recipient cells) to quantify the percentage of miRFP670 DNA delivery, which describes the amount of recipient cells that receive miRFP670 payload that was loaded into the fusosomes via sonication.
[001846] [001846] With this assay, the miRFP670 DNA-loaded fusosome showed an observable level of miRFP670 delivery corresponding to 2.9 +/- 0.4% of miRFP670 positive cells out of the total BFP-positive receptor cells (Figure 37). Receptor cells treated only with miRFP670 DNA, only the fusosome or sonicated fusosome did not show positive miRFP670 positive cells (defined as <0.5%).
[001847] [001847] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells, expressing the glycoprotein G of the vesicular stomatitis virus (VSV-G) envelope on the cell surface and expressing the recombinase protein Cre , as described here. A load of protein was then loaded onto VSV-G fusosomes by ultrasound, as described in Lamichhane, TN, et al., Oncogene Knockdown via Active Loading of Small RNAs into Extracellular Vesicles by Sonication. Cell Mol Bioeng, (2016). In this experiment, the protein load was a bovine serum albumin protein conjugated to the fluororescent dye Alexa Fluor 647 (BSA-AF647; ThermoFisher Catalog number A3S4785). Protein-loaded fusosomes were then used to treat and deliver payload to show HEK-293T target cells modified to express a "loxP-BFP-stop-loxP-Clover" cassette, with a CMV promoter.
[001848] [001848] Briefly, approximately 10º fusosomes corresponding to 50 µl of a standard VSV-G fusosome preparation were mixed with 10 µg of BSA-AF647 and incubated at room temperature for 30 minutes. The fusosome / protein mixture was then sonicated for 30 seconds at room temperature using a water bath sonicator (Brason model% 1510R-DTH) operated at 40kHz. The mixture was then placed on ice for one minute, followed by a second round of sonication at 40kHz for 30 seconds. The mixture was then centrifuged at 16,000 g for 5 minutes at 4ºC to granulate fusosomes containing BSA-AF647. The supernatant containing unincorporated protein was removed and the granule was resuspended in phosphate buffered saline. After loading the protein, the loaded fusosomes were kept on ice before
[001849] [001849] HEK-293T receptor cells designed to express a "Loxp-BFP-stop-Loxp-Clover" cassette were plated
[001850] [001850] The acquisition settings were defined so that the intensities of BFP, Clover and BSA-AF647 reach the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the Clover and BSA-AF647 channels. BSA-AF647 positive cell analysis was performed with the Gen5 software provided with an automatic fluorescent microscope - (see - www .biotek.com / products / software-robotics- software / gen5-microplate-reader-and-imager- software /).
[001851] [001851] The images were pre-processed using a rolling ball background subtraction algorithm with a width of 60 µm. Cells with BFP intensity significantly above background intensities were thresholded and areas too small or large to be BFP positive cells were excluded. The same analysis steps were applied to the Clover and BSA-AF647 channels. The number of BSA-AF647-positive cells (recipient cells that receive the BSA-AF647 protein) was then divided by the sum of the BFP-positive cells (total recipient cells) to quantify the BSA-AF647 delivery percentage. , which describes the number of recipient cells that receive a payload of BSA-AF647 protein that was loaded into the fusosomes by sonication.
[001852] [001852] With this assay, the BSA-AF647-loaded fusosome showed an observable level of BSA-AF647 delivery corresponding to 43.2 +/- 0.2% BSA-AF647 positive cells out of the total recipient cells positive for BFP (Figure 38). Receptor cells treated with BSA-AF647 protein alone, only the fusosome or sonicated fusosome alone did not show positive cells for BSA-AF647 (defined as less than 5%). EXAMPLE 145: GENERATION AND ISOLATION OF FU-GHOST SOSOMES
[001853] [001853] This example describes the generation and isolation of fusosome phantasms by means of hypotonic treatment and centrifugation. This is one of the methods by which fusosomes can be produced.
[001854] [001854] Phantom fusosomes were generated from HEK-293T cells that express the envelope of the vesicular stomatitis virus (VSV-G) glycoprotein, as described herein. Fososome ghosts were generated and analyzed by Fluorescent Nanoparticle Tracking Analysis (fNTA).
[001855] [001855] Fusosomes were prepared as follows. 9.2 x 10 th HEK-293T cells were reverse transfected using a polymeric transfection reagent with 10 µg of the expression plasmid pcDNA3.1 containing the open reading frame for VSVg and 15 µg of the expression plasmid pcDNA3.1 empty at 7, 5 ml of complete (DMEM + 10% FBS + 1x Pen / Strep) on a 100 mm collagen-coated plate. To produce phantom ghosts, 24 hours after transfection, cells were washed with phosphate-buffered saline (PBS), dissociated with TryPLE, centrifuged 500x g, 5 minutes and resuspended in medium. 1 x 10 ”cells were resuspended in 7 ml of PBS and granulated by centrifugation at 500x g for 5 min. The cells were resuspended in cold TM buffer (10 MM Tris, MgCl2 1.6, pH 7.4) and sonicated for 5 sec at 27% amplitude (ColeParmer Catalog No. CPX130). Immediately after sonication, the TM buffer containing sucrose (60% w / v) was added to the solution at a final concentration of 0.25M sucrose. The solution was then centrifuged at 6,000x g, 4ºC for 15 min. The supernatant was discarded and the granule was washed twice in 0.25M sucrose buffer, pH 7.4. The pellet was then resuspended in 0.25M sucrose buffer, pH 7.4 and the resuspended pellet was then sonicated for 5 seconds at 27% amplitude (ColeParmer Catalog No. CPX130). The solution was then centrifuged at 6,000x g, 4ºC for 15 min. The supernatant was discarded and the granule was washed twice in 0.25M sucrose buffer, pH 7.4. The granule was then resuspended in 0.25M sucrose buffer, pH 7.4 and the resuspended granule was then sonicated for 2 min at 27% amplitude (ColeParmer Catalog No. CPX130). The solution was then centrifuged at 800x g, 4ºC for 15 min and then filtered through a 0.45 µm syringe filter.
[001856] [001856] Finally, to concentrate the phantom phantoms, the solution was ultra-centrifuged at 150,000x g, 4ºC for 45 min and the pellet containing the phantom phantoms was re-suspended in PBS. To analyze the phantom phantom composition via fNTA, the phantom phantoms were incubated 1: 1 with CellMask Orange (ThermorFisher) and then diluted 1: 1,000 before being loaded into the tracking machine and analyzed by manufacturer's instructions. The size distribution of the fusosome ghosts is shown in Figure 39. Fusosomes have been successfully generated by preparing ghosts from HEK-293T cells expressing VSV-G. EXAMPLE 146: LACK OF TRANSLATION ACTIVITY IN FUSES- SUMMITS
[001857] [001857] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface, as described here. The control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. Translational activity of fusosomes was then compared to parental cells, for example, cells of origin, used for the generation of fusosomes using the EdU Imaging Click-on Kit (ThermoFisher).
[001858] [001858] In summary, approximately 3x10º fusosomes corresponding to 60 ul of a standard VSV-G fusosome preparation and 1x10º6 parental cells used to generate the fusosomes were plated in triplicate, 1 ml of complete medium in a multiple well of 6 wells and low attachment plate in full containing 1 mM fluorescent taggable-alkaline-nucleoside EdU for 4hr at 37ºC and 5% CO ». For the negative control, were 3x10º fusosomes were plated on a 6-well low-fixation multi-well plate in complete medium, but without alkaline-nucleoside EdU. After 4 hours of incubation
[001859] [001859] For data analysis, the FSC and SSC channels were adjusted on the linear axis to determine a representative population of cells or fusosomes. This population was then blocked and events only within this gate were used to display events in the 670 +/- 14nm emission channel on a logarithmic scale. The negative control emission 670 +/- 14 nm was used to determine where to place the gate in the histogram, so that the gate included less than 1% positive. Using the analysis criteria listed above, the parental cells demonstrated 56.17% + 8.13 Edu events: 647, as a surrogate measure of translation activity, including Edu in the newly synthesized DNA, while fusosomes demonstrated 6.23% + 4.65 AF488 events (Figure 40, left panel). The median fluorescence intensity of AF647, a measure of Edu incorporation, and therefore a relative measure of newly synthesized DNA, was 1311 + 426.2 events for parent cells and 116.6 + 40.74 for fusosomes (Figure 40, right panel).
[001860] [001860] Fusosomes were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoprotein G of the vesicular stomatitis virus envelope (VSV-G) on the cell surface, as described here. The control particles (non-fusogenic fusosomes) were produced from HEK-293T cells, transiently transfected transiently with the empty vector pcDNA3.1. Fusosomes and parent cells were then tested for their ability to polymerize actin (over time), using a phalidine rhodamine-flow cytometry and Tubulin ELISA assay. Briefly, approximately 1x10º fusosomes corresponding to 60 ul of a standard VSV-G fusosome preparation and 1x10º parental cells used to generate the fusosomes were plated in 1 ml of complete medium in a 96-well, low multi-link titration plate -wells completely and incubated at 37ºC and 5% CO ». The samples were collected periodically, at 3 hours, 5 hours and 24 hours after coating. The samples were centrifuged at 21,000xg for 10 minutes, resuspended in 200ul of 4% (v / v) PFA in phosphate buffered saline for 10 minutes, washed with 1ml of phosphate buffered saline, centrifuged at 21,000xg for 10 minutes. minutes, washed again and stored at 4ºC until later use.
[001861] [001861] For staining with rhoamine-phalloidin, the samples were centrifuged at 21,000xg for 10 minutes and incubated in 100ul of 0.1% (v / v) Tri-ton X-100 in phosphate-buffered saline for minutes. After a 20-minute incubation, an additional 100 μl of 0.1% (v / v) Tri-X-100 in phosphate buffered saline containing 165 um rhodamine-phaloidin was added to the sample and mixed pipette , with negative control received and an additional 100 ul of 100 ul of 0.1% (v / v) Triton X-100 only in phosphate buffered saline. The samples were incubated for 45 minutes before being washed with 1 ml of phosphate-buffered saline, centrifuged at 21,000xg for 10 minutes, washed again and resuspended in 300ul of phosphate-buffered saline and analyzed by flow cytometry. (Attune, ThermoFisher) using a 561 nm Exc laser for excitation and emission of the 585 +/- 16nhnm filter, as shown in the table below:
[001862] [001862] Attune NxT software was used for FlowJo acquisition and analysis. For data acquisition, the FSC and SSC channels were adjusted on the linear axis to determine a representative population of cells or fusosomes. This population was then blocked and events only within this port were used to display events on the 585 +/- 16hnm broadcast channel on a logarithmic scale. A minimum of
[001863] [001863] This example describes the quantification of antibody titers against recipient cells (cells that fused with spindles) using flow cytometry. A measure of the immunogenicity of the recipient cells is the antibody response. Antibodies that recognize recipient cells can bind in ways that limit cell activity or longevity. In one embodiment, the recipient cells will not be directed by an antibody response or an antibody response will be below a reference level.
[001864] [001864] In this example, antibody titers of anti-receptor cells in a subject (for example, human, mouse or monkey) are tested. In addition, the protocol can be adapted to any cell type for which suitable surface markers exist. In this example, the destination recipient cell is a CD3 + cell.
[001865] [001865] Mice are treated with fusosomes produced using any of the methods described in this application or with
[001866] [001866] The classified CD3 + cells are then stained with IgM antibodies by incubating the reaction mixture with PE-conjugated goat antibodies specific for the Fc portion of the mouse IgM (BD Bioscience) at 4ºC for 45 min. Notably, secondary anti-IgG1 or mouse IgG2 antibodies can also be used. The cells of all groups are washed twice with PBS containing 2% FCS and then analyzed in a FACS system (BD Biosciences). Fluorescence data are collected by logarithmic amplification and expressed as average fluorescent intensity. The average fluorescence intensity is calculated for CD3 cells classified from mice treated with fusosomes and mice treated with PBS.
[001867] [001867] A low mean fluorescence intensity is indicative of a low humoral response against recipient cells. PBS-treated mice are expected to have low mean fluorescence intensity. In one embodiment, the average fluorescence intensity will be similar for recipient cells from mice treated with fusosomes and mice treated with PBS.
[001868] [001868] This example describes the quantification of the response of macrophages against recipient cells with a phagocytosis assay.
[001869] [001869] A measure of the immunogenicity of the recipient cells is the response of the macrophages. Macrophages become involved in phagocytosis, swallowing cells and allowing the sequestration and destruction of foreign invaders, such as bacteria or dead cells. In some modes, phagocytosis of receptor cells by macrophages would reduce their activity.
[001870] [001870] In one embodiment, the recipient cells are not directed by macrophages. In this example, the response of macrophages to recipient cells in a subject is tested. In addition, the protocol can be adapted to any cell type for which suitable surface markers exist. In this example, the destination recipient cell is a CD3 + cell.
[001871] [001871] The mice are treated with fusosomes produced by any of the methods described in this application or with PBS (negative control) daily for 5 days. 28 days after the final treatment, peripheral blood is collected from mice that received fusosomes and mice that received treatment with PBS. Blood is collected in 1 ml of PBS containing 5 μM EDTA and mixed immediately to prevent clotting. The tubes are kept on ice and the red blood cells are removed using an ammonium chloride buffered solution (ACK).
[001872] [001872] The cells are stained with a murine CD3-FITC antibody (Thermo Fisher catalog number: 11-0032-82), at 4ºC for 30 minutes in the dark, after being blocked with bovine serum albumin
[001873] [001873] A phagocytosis assay is performed to assess macrophage-mediated immune clearance, according to the following protocol. Macrophages are bathed immediately after collection in confocal plates with a glass bottom. The macrophages are incubated in DMEM + 10% FBS + 1% P / S for 1 h to bind. An appropriate number of CD3 + cells classified and stained with FITC derived from mice that received fusosomes and PBS are added to the macrophages, as indicated in the protocol, and are incubated for 2 hours, for example, as described in tools.thermofisher .com / con-ent / sfs / manuals / mp06694 pdf.
[001874] [001874] After 2 h, the plate is washed gently and the intracellular fluorescence is examined. To identify macrophages, cells are first incubated with Fc receptor blocking antibody (eBioscence cat. No. 14-0161-86, clone 93) for 15 min on ice to block the binding of labeled mAbs to Fc receptors, which are abundant. - expressed in macrophages. After this step, anti-F4 / 80-PE (ThermofFisher cat. 12-4801-82, clone BM8) and anti-CD11b-PerCP-Cy5.5 (BD Biosciences cat. 550993, antibodies conjugated to clone M1 / 70 ) are added to macrophage surface antigen dyes. The cells are incubated for 30 min in the dark at 4ºC, followed by centrifugation and washing in PBS. The cells are then resuspended in PBS. The flow cytometry of the samples is then performed and the macrophages are identified via positive fluorescence signal for F4 / 80-PE and CD11b-PerCP-Cy5.5, using laser excitation of 533 nm and 647 nm, respectively. After macrophages are attached, fluorescence
[001875] [001875] A low phagocytic index is indicative of low phagocytosis and targeting by macrophages. PBS-treated mice are expected to have a low phagocytic index. In one mode, the phagocytic index will be similar for recipient cells derived from mice treated with fusosomes and mice treated with PBS.
[001876] [001876] This example describes the quantification of a PBMC response against recipient cells with a cell lysis assay.
[001877] [001877] A measure of the immunogenicity of the recipient cells is the PBMC response. In one embodiment, cell lysis mediated by cytotoxicity of recipient cells by PBMCs is a measure of immunogenicity, as lysis will reduce, for example, inhibit or interrupt the activity of a fusosome.
[001878] [001878] In one embodiment, the recipient cells do not elicit a PBMC response. In this example, the PBMC response against recipient cells in a subject is tested.
[001879] [001879] In addition, the protocol can be adapted to any type of cell for which suitable surface markers exist. In this example, the destination recipient cell is a CD3 + cell.
[001880] [001880] The mice are treated with fusosomes produced by any of the methods described in this application or with PBS (negative control) daily for 5 days. 28 days after treatment
[001881] [001881] 7 days before isolation of CD3 + cells from mice treated with fusomes or PBS, PBMCs are isolated from mice treated with fusosomes or PBS according to the methods of Crop et al. Cell transplantation (20): 1547-1559; 2011 and simulated in the presence of recombinant mouse protein | IL-2 (R&D Systems catalog number: 402-ML-020) and CD3 / CD28 beads (ThermoFisher catalog number: 11456D) in a 96-well titration plate of round bottom for 7 days at 37C. On day 7, the stimulated PBMCs are co-incubated with CD3 + / CMG + control cells or
[001882] [001882] Data are analyzed by looking at the percentage of CD3 + / CMG + cells in the total cell population. When comparing treatment groups, a relatively lower percentage of CD3 + / CMG + cells in any given PBMC cell assay ratio: CD3 + / CMG + is indicative of receptor cell lysis. In a fashion, the percentage of CD3 + / CMG + will be similar for recipient cells derived from mice treated with fusosomes and mice treated with PBS.
[001883] [001883] This example describes the quantification of a natural response of killer cells against recipient cells with a cell lysis assay.
[001884] [001884] A measure of the immunogenicity of the recipient cells is the natural response of the killer cells. In one embodiment, cell lysis mediated by cytotoxicity of recipient cells by natural killer cells is a measure of immunogenicity, since lysis will reduce, for example, inhibit or interrupt the activity of a fusosome.
[001885] [001885] In one embodiment, the recipient cells do not elicit a natural response from the killer cells. In this example, the killer's natural response to recipient cells in a subject is tested. In addition, the protocol can be adapted to any type of cell for which suitable surface markers exist. In this example, the destination recipient cell is a CD3 + cell.
[001886] [001886] The mice are treated with fusosomes produced by any of the methods described in this application or with PBS (negative control) daily for 5 days. 28 days after the final treatment, peripheral blood is collected from mice that received fusosomes and mice that received treatment with PBS. Blood is collected in 1 ml of PBS containing 5 μM EDTA and mixed immediately to prevent clotting. The tubes are kept on ice and the red blood cells are removed using an ammonium chloride buffered solution (ACK). The cells are stained with a murine CD3: APC-Cy7 antibody (Bi-olgend Catalog No.: 100330) or an isotype control APC-Cy7 antibody (Biolgend Catalog: 400230) at 4ºC for 30 minutes in the dark , after being blocked by Fc (Biolgend catalog number: 101319) in cell staining buffer (Biolgend catalog number: 420201) for 10 minutes.
[001887] [001887] 7 days before isolation of CD3 + cells from mice treated with fusomes or PBS, NK cells are isolated from mice treated with fusosomes or PBS according to the methods of Crop et al. Cell transplantation (20): 1547-1559; 2011 and simulated in the presence of recombinant mouse protein | IL-2 (R&D Systems catalog number: 402-ML-020) and CD3 / CD28 beads (ThermoFisher catalog number: 11456D) in a 96-well titration plate of round bottom for 7 days at 37C. On day 7, stimulated NK cells are matched with CD3 + / CMG + or CD3 + / DMSO control cells for 1, 2, 3, 4, 5, 6, 8, 10, 15, 20, 24, 48 hours in a ratio of NK cells: CD3 + / CMG + or NK cells: CD3 + / DMSO control cells ranging from 1000: 1 to 1: 1 and 1: 1.25 to 1: 1000. A negative control that a set of wells would receive only CD3 + / CMG + and CD3 + / DMSO control cells, without NK cells. After incubation, the plates are centrifuged and processed to be labeled with the murine CD3: APC-Cy7 antibody or an IC: APC-Cy7 antibody, as above. After washing twice with PBS, the cells are resuspended in PBS and analyzed in a FACS Aria (APC-Cy7: 640 nm laser excitation / emission collected at 780 - / + 60 nm and CMG laser excitation / emission 561 nm collected at 585 - / + 16 nm) running the FACSDivaTY software
[001888] [001888] Data are analyzed by looking at the percentage of CD3 + / CMG + cells in the total cell population. When comparing treatment groups, a relatively lower percentage of CD3 + / CMG + cells in any given NK cell assay ratio: CD3 + / CMG + cells is indicative of recipient cell lysis. In one mode, the percentage of CD3 + / CMG + will be similar for recipient cells derived from mice treated with fusosomes and mice treated with PBS.
[001889] [001889] This example describes the quantification of a CD8 + T cell response against recipient cells (cells that fused with fusosomes) with a cell lysis assay.
[001890] [001890] A measure of the immunogenicity of recipient cells is the response of CD8 + T cells. In one embodiment, cell lysis mediated by cytotoxicity of recipient cells by CD8 + T cells is a measure of immunogenicity, as lysis will reduce, for example, inhibit or interrupt the activity of a fusosome.
[001891] [001891] In one embodiment, the recipient cells do not elicit a CD8 + T cell response. In this example, the CD8 + T cell response against recipient cells in a subject is tested. In addition, the protocol can be adapted to any type of cell for which suitable surface markers exist. In this example, the destination recipient cell is a CD3 + cell.
[001892] [001892] The mice are treated with fusosomes produced using any of the methods described in this application or with PBS (negative control) daily for 5 days. 28 days after the final treatment, peripheral blood is collected from mice that received fusosomes and mice that received treatment with PBS. Blood is collected in 1 ml of PBS containing 5 μM EDTA and mixed immediately to prevent clotting. The tubes are kept on ice and the red blood cells are removed using an ammonium chloride buffered solution (ACK). The cells are stained with a murine CD3: APC-Cy7 antibody (Bi-olgend Catalog No.: 100330) or an isotype control APC-Cy7 antibody (Biolgend Catalog: 400230) at 4ºC for 30 minutes in the dark , after being blocked by Fc (Biolgend catalog number: 101319) in cell staining buffer (Biolgend catalog number: 420201) for 10 minutes. After being washed twice with PBS, the cells are analyzed in a FACS Aria (BD Biosciences, San Jose, CA.) with excitation and laser emission of 640 nm, collected at 780 - / + 60 nm, using the FACSDiva 'software "Y (BD Biosciences, San Jose, CA.) to define negative ports using APC-Cy7 isotype control antibody-activated cells, and then APC-Cy7 positive cells are sorted and collected. CD3 + cells are classified they are then marked with the CellMask'TY green plasma membrane stain (CMG, ThermoFisher catalog number: C37608).
[001893] [001893] 7 days before isolation of CD3 + cells from mice treated with fusomes or PBS, CD8 + cells are isolated from mice treated with fusosomes or PBS according to the methods of Crop et al. Cell transplantation (20): 1547-1559; 2011 and simulated in the presence of recombinant mouse protein | IL-2
[001894] [001894] Data are analyzed by looking at the percentage of CD3 + / CMG + cells in the total cell population. When comparing treatment groups, a relatively lower percentage of CD3 + / CMG + cells in any proportion of CD8 + cell assays: CD3 + / CMG + cells is indicative of receptor cell lysis. In one embodiment, the percentage of CD3 + / CMG + will be similar for recipient cells derived from mice treated with fusosomes and mice treated with PBS. EXAMPLE 149: GAPDH MEASUREMENT IN FUSOSOMES
[001895] [001895] This example describes the quantification of the level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in fusosomes and the relative level of GAPDH in fusosomes compared to the parent cells. Fusosomes were prepared as described in Examples 114 and 154.
[001896] [001896] GAPDH was measured in parental cells and fusosomes using a commercially available standard ELISA for GAPDH (ab176642, Abcam) according to the manufacturer's instructions. Total protein levels were similarly measured using the bicinconinic acid assay. The measured levels of GAPDH and protein are shown in the table below: [Protein] [GAPDH] GAPDH: oem protein and fa GAPDH: Total protein ratios are also shown in Figure 41.
[001897] [001897] This example describes the quantification of the ratio of lipid mass to protein mass in fusosomes. It is contemplated that fusosomes may have a lipid mass to protein mass ratio similar to that of nucleated cells. Fusosomes and parental cells were prepared as described here in Examples 114 and 154.
[001898] [001898] Lipid content was calculated using phospholipids based on
[001899] [001899] This example describes the quantification of the ratio between the mass of protein and the mass of DNA in the fusosomes. It is contemplated that fusosomes can have a mass ratio of protein to DNA mass that is much greater than that of cells. Fusosomes were prepared as described in Examples 114 and
[001900] [001900] The total protein content of fusosomes and cells was measured via bicinconinic acid, as described herein. The DNA mass of fusosomes and cells was measured by absorption at 280 nm after extracting the total DNA using a commercially available isolation kit (* 69504 Qiagen Hilden, Germany) according to the manufacturer's instructions. The ratio of proteins to total nucleic acids was determined by dividing the total protein content by the total DNA content to produce a ratio within a certain range for a typical fusosome preparation. Measured protein levels, DNA levels and the protein to DNA ratio are shown in Figure 43 and the table below:
[001901] [001901] This example describes the quantification of the ratio of lipids to DNA in fusosomes compared to parent cells. In one embodiment, fusosomes will have a higher ratio of lipids to DNA compared to parental cells. Fusosomes were prepared as described previously in Examples 114 and 154.
[001902] [001902] This ratio is defined as the lipid content described in Example 49, and the nucleic acid content is determined as described in Example 50. Measured lipid levels, DNA levels and the lipid proportion for DNA are shown in Figure 44 and the table below: eipdes0y [DNA (6) | Hindes ONA Gimalimo | EXAMPLE 153: DELIVERY OF FUSOSOMES THROUGH A DYNAMINE MEDIATED ROUTE
[001903] [001903] This example describes the delivery of Cre based on the fososome to recipient cells via a dynamin-mediated pathway. Briefly, the fusosomes encapsulating Cre were generated by the standard procedure for collection and preparation of spindle sums produced from HEK-293T cells that express the glycoprotein G of the envelope of the vesicular stomatitis virus (VSV-G) on the cell surface , as described here. The dependence on the delivery of Cre in a dinamine-mediated pathway was then determined as follows.
[001904] [001904] HEK-293T receptor cells designed to express a "LoxP-GFP-stop-LoxP-RFP" cassette were plated
[001905] [001905] To quantify the extent to which Cre delivery depends on a dinamine-mediated pathway, at the time of application of the fososome, a group of recipient cells was treated with the dinin inhibitor Dynasore at 120 uM, a concentration sufficient to partially inhibit endocytosis via dinamine. Fusosomes were incubated with recipient cells for 24 hours at 37ºC and 5% CO, ». Twenty-four hours later, 1 µg / ml of Hoechst 33342 was diluted in complete medium and incubated with the cells for 30 minutes at 37ºC and 5% CO>. After adding Hoescht, the cells were photographed using an automatic microscope (www.biotek.com/products/imaging-microscopy-automated-cell-imagers / lionheart-fx-automated-live-cell-imager /). The Hoechst fluorescence of the recipient cells was photographed using the 405 nm BFP LED and BFP filter cube. The GFP fluorescence of the recipient cells was photographed using the 488 nm LED and the GFP filter cube. The RFP fluorescence of the recipient cells was photographed using the 523 nm RFP and LED filter cube. The images of the cells in the well were acquired by first establishing the LED intensity and the integration times in a positive control well; that is, recipient cells treated with 1.25 µl of recombinase gesicles (Takara, Catalog No. 631449).
[001906] [001906] The acquisition settings were defined so that the intensities of BFP, GFP and RFP reached the maximum values of pixel intensity, but not saturated. The wells of interest were then photographed using the established settings. The focus was defined in each well, automatically focusing on the BFP channel and then using the focal plane established for the GFP and RFP channels. The analysis of the positive cells for RFP was performed with the Gen5 software provided with an automated fluorescent microscope (see www.biotek.com/products/software-robotics-software/genS5-microplate- reader-and-imager-software /).
[001907] [001907] The images were pre-processed using a subtraction algorithm of a rolling ball background with a width of 60 µm. Cells with GFP intensity significantly above background intensities were thresholded and areas too small or large to be GFP positive cells were excluded. The same analysis steps were applied to the RFP channel. The number of positive cells for RFP (recipient cells receiving Cre recombinase) was then divided by the sum of the positive cells for GFP (total recipient cells) to quantify the percentage of positive cells for RFP, as a metric for the delivery of Cre .
[001908] [001908] In the absence of Dynasore, Cre-loaded fusosomes showed an observable level of Cre delivery corresponding to 82.1 +/- 4.5% of positive RFP cells out of the total GFP positive receptor cells (Figure 45). As noted above, the Dynasore concentration used was sufficient to partially inhibit endocytosis. Consistent with this, the VSV-G fusosomes used in this example, which are known to operate by an endocytic route, were partially inhibited in the presence of 120 µM Dynasore, with a Cre delivery level corresponding to 68.5 +/- 5 , 5% positive for RFP cells (Figure 45). The untreated recipient cells did not show appreciable RFP positive cells. Taken together, these data illustrate the dinamine dependence on fusosome-based Cre delivery.
[001909] [001909] This example describes the quantification of the lipid composition of fusosomes. It is contemplated that the lipid composition of fusosomes may be similar to the cells from which they are derived. The lipid composition affects important biophysical parameters of fossa and cells, such as size, electrostatic interactions and colloidal behavior.
[001910] [001910] The lipid measurements were based on mass spectrometry. Fusosomes were prepared as described herein by transient transfection of VSV-G and GFP in 10 cm plates, followed by filtration and ultracentrifugation of the conditioned medium 48 h after transfection to obtain fusosomes. The transfected cells were harvested in parallel to the conditioned medium and subjected to analysis. Exosomes were also harvested from cells that were not transfected with VSV-G or GFP.
[001911] [001911] Lipid analysis based on mass spectrometry was performed by Lipotype GmbH (Dresden, Germany), as described (Sampaio et al. 2011). The lipids were extracted using a two-stage chloroform / methanol procedure (Ejsing et al. 2009). The samples were added with the standard internal lipid mixture containing: cardiolipin 16: 1/15: 0/15: 0/15: 0 (CL), ceramide 18: 1; 2/17: 0 (Cer), diacylglycerol 17: 0 / 17: 0 (DAG), hexosilceramide 18: 1; 2/12: 0 (HexCer), smooth phosphatidyl 17: 0 (LPA), smooth phosphatidylcholine 12: 0 (LPC), smooth phosphatidylethanolamine 17: 1 (LPE ), smooth phosphatidylglycerol 17: 1 (LPG), smooth phosphatidylinositol 17: 1 (LPI), smooth phosphatidyl serine 17: 1 (LPS), phosphatidate 17: 0/17: 0 (PA), phosphatidylcholine 17: 0/17 : 0 (PC), phosphatidylethanolamine 17: 0/17: 0 (PE), phosphatidylglycerol 17: 0/17: 0 (PG), phosphatidylinositol 16: 0/16: 0 (PI), phosphatidyl serine 17: 0 / 17: 0 (PS), cholesterol ester 20: 0 (EC), sphingomyelin 18: 1; 2/12: 0; 0 (SM), triacylglycerol
[001912] [001912] After extraction, the organic phase was transferred to an infusion plate and dried in a vacuum speed concentrator. The dry extract of the first step was resuspended in 7.5 mM ammonium acetate in chloroform / methanol / propanol (1: 2: 4, V: V: V) and the dry extract of the second step in a 33% ethylamine solution. methylamine in chloroform / methanol (0.003: 5: 1; V: V: V). All liquid handling steps were performed using the Hamilton Robotic STARIet robotic platform with the Anti Droplet Control feature for pipetting organic solvents.
[001913] [001913] The samples were analyzed by direct infusion on a QExactive mass spectrometer (Thermo Scientific) equipped with a TriVersa NanoMate ion source (Advion Biosciences). The samples were analyzed in positive and negative ion modes, with a resolution of Rm = 200 = 280,000 for MS and Rm, = 200 = 17,500 for MSMS experiments, in a single acquisition. The MSMS was triggered by an inclusion list that covers the mass intervals corresponding to the digitized MS in 1 Da increments (Surma et al. 2015). MS and MSMS data were combined to monitor CE, DAG and TAG ions as ammonium adducts; PC, PC O-, as acetate adducts; and CL, PA, PE, PE O-, PG, Pl and PS as deprotected anions. MS was used only to monitor LPA, LPE, LPE O-, LPI and LPS as deprotonated anions; Cer, HexCer, SM, LPC and LPC O- as acetate and cholesterol adducts as ammonium adducts of an acetylated derivative (Liebisch et al. 2006).
[001914] [001914] The data were analyzed with the internal lipid identification software developed based on the LipidXplorer (Herzog et al. 2011; Herzog et al. 2012). Post-processing and data normalization were performed using an in-house data management system. Only lipid identifications with a signal / noise ratio> 5 and a signal intensity 5 times greater than in the corresponding blank samples were considered for further data analysis.
[001915] [001915] The fusosome lipid composition was compared to the lipid compositions of the parental cells, with lipid species not detected with zero value. The lipid species identified in the spindles and in the parental cells are shown in the table below: Species - lipid- Lipid species | Fraction of es- Total es- | shared-shared lipid species | (identified with 25% of ex | shared cas identifies | in cells for parental pressure | in lipids of rentas and in fusosomes such fusomas) Cells for 569 548 0,700 783 rent
[001916] [001916] It is contemplated that fusosomes and parental cells may have a similar lipid composition if> 70% of the identified lipid species in any replicated sample of the parental cells are present in any replicated sample of the identified fumes and lipids, the mean level in the fusosome can be> 25% of the corresponding mean level of lipid species in the parental cell. EXAMPLE 155: MEASUREMENT OF PROTEOMIC COMPOSITION IN FUSOSOMES
[001917] [001917] This example describes the quantification of the prosthetic composition of fusosomes. It is contemplated that the protein composition of fusosomes may be similar to the parental cells from which they are derived.
[001918] [001918] Fusosomes and parental cells were prepared as described herein by the method of Examples 114 and 154.
[001919] [001919] Each sample was resuspended in lysis buffer (6 M urea, 2 M thiourea, 4% CHAPS, 50 mM Tris pH 8.0), sonicated in an ice bath and passed through a small syringe . The proteins were reduced with 10 mM DTT for 15 minutes at 65ºC and alkylated with 15 mM iodoacetamide (IAA) for 30 minutes in the dark at room temperature. Excess IAA was extinguished with an additional 10 mM DTT. The proteins were then precipitated with the addition of 8 volumes of ice-cold acetone + 1 volume of ice-cold methanol and placed at -80ºC overnight. The precipitated proteins were granulated by centrifugation. The remaining lysis buffer was washed with 200 µl of chilled methanol 3 times. The proteins were resuspended in 0.75 M urea + 50 MM Tris pH 8.0 + 1 µg of trypsin / LysC and pre-digested for 4 hours at 37ºC with agitation. An additional 1 µg of trypsin / LysC was added to the proteins and digestion was continued overnight. The peptides were purified by reverse phase SPE and analyzed by LC-MS.
[001920] [001920] A replicated sample for each condition was lysed and combined in a tube. This set was then subjected to the same preparation protocol as the samples and analyzed by LC-MS in information-dependent acquisition or separated into a gel as described below.
[001921] [001921] A total of 100 µg of collected proteins was placed in 2x Laemmli loading buffer and separated into 12.5% SDS PAGE. The proteins were briefly stained with Co-massie blue and the protein strips were separated into 12 fractions. Each fraction was then dehydrated with 50% acetonitrile and rehydrated with 10 mM DTT for reduction. The pieces of gel were placed at 65ºC for 15 minutes and alkylated for 30 minutes at room temperature with 15 mM IAA in the dark. The gels were subsequently dehydrated with 50% acetonitrile and rehydrated in 50 mM Tris, pH 8 with 1 µg of trypsin / LysC overnight at 37ºC. The peptides were extracted from the gel by dehydration and sonication. The peptides were purified by reverse phase SPE and analyzed by LC-MS / MS (1xIDA per fraction).
[001922] [001922] The acquisition was carried out with an ABSciex TripleTOF 5600 (ABSciex, Foster City, CA, USA) equipped with an electrospray interface with an iD capillary of 25 μm and coupled to an Ukshent uUHPLC (Eksigent, Redwood City, CA , USA). Analyst TF software
[001923] [001923] To generate the ion library for the analysis of the samples, the ProteinPilot software was executed in the wiff files generated by the IDA executions. This database was used in the Peakview software (ABSciex) to quantify the proteins in each of the samples, using 3 transition / peptide and 15 peptide / protein. To maximize the number of quantified proteins, the samples were quantified in a publicly available human SWATH database (Atlas) with the same parameters. A peptide was considered as properly measured if the score calculated by Peakview was greater than 1.5 and had an RDR <1%. The quantification of each database was combined into a final quantification using the protein name from both databases. A correction factor was calculated for each sample, taking into account the total signal of each protein in that sample, when compared with the average of the total signal of each sample.
[001924] [001924] The proteomic composition of the fusosome has been compared to the proteomic composition of the parental cell. A similar protein composition between fusosomes and parental cells was observed when> 33% of the identified proteins were present in the fusosome and, in these identified proteins, the level was> 25% of the corresponding protein level in the parental cell, as shown in The table below.
[001925] [001925] This example describes the quantification of an endogenous or synthetic protein charge in fusosomes. Fusosomes may, in some cases, comprise an endogenous or synthetic protein load. The fusosome or parental cell described in this Example was designed to alter the expression of an endogenous protein or to express a synthetic charge that mediates therapeutic cell function.
[001926] [001926] Fusosomes and parental cells expressing GFP were prepared as described here by the method of Examples 114 and 154. Quantification of GFP in fusosomes was performed using a commercially available ELISA kit (ab171581 Abcam Cambridge, United Kingdom) according to the manufacturer's instructions. The quantification of the fusosome was performed by Nanoparticle Tracking Analysis using a NanoSight NS300 (Malvern Instruments, Malvern, Worcestershire, United Kingdom). The results are shown in the table below. the JAR
[001927] [001927] It is contemplated that fusosomes can have at least 1, 2,3, 4, 5, 10, 20, 50, 100, or more of protein agent molecules per fusosome. In one embodiment, fusosomes will have 166 molecules of protein agent per fusosome. EXAMPLE 157: MEASURING EXOSTER PROTEIN MARKERS SOMICS IN FUSOSOMES
[001928] [001928] This assay describes the quantification of the proportion of proteins that are known to be specific markers of exosomes.
[001929] [001929] Fusosomes were prepared as described herein by the method of Examples 114 and 154. Exosomes were prepared as described herein for fusosomes by the method of Examples 114 and 154, with the exception that the parental cells were not transfected with VSV- G or GFP. Protein quantification by mass spectrometry for fusosomes and exosomes was performed as described here in Example 42.
[001930] [001930] The data resulting from protein quantification were analyzed to determine the levels and proportions of proteins of the known exosomal marker CD63. The average log intensities per group were calculated by adding 1 to the intensity values of the mass spectrometry, transforming by log10 and calculating the average between repetitions. The results are shown in figure 46. EXAMPLE 158: CALNEXIN MEASUREMENT IN FUSOSOMES
[001931] [001931] This assay describes the quantification of the level of calnexin (CNX) in fusosomes and the relative level of CNX in fusosomes compared to parental cells.
[001932] [001932] Fusosomes and parental cells were prepared as described here in Examples 114 and 154. Calnexin and total protein were measured using mass spectrometry conducted according to the method of Example 42. The intensity of the determined calnexin signal for parental cells and fusosomes is shown in Figure
[001933] [001933] In the modalities, using this assay, the average fractional content (calculated as described here in Example 42) of CNX in the fusosomes will be <2.43 x 10º.
[001934] [001934] In one embodiment, the decrease in total protein calnexin in ng / ug of the parental cell for the preparation will be greater than 88%. EXAMPLE 159: PROPORTION OF LIPIDS FOR DNA IN SPINDLES SUMMITS
[001935] [001935] This example describes the quantification of the ratio of lipids to DNA in fusosomes compared to parent cells. In one embodiment, fusosomes will have a higher ratio of lipids to DNA compared to parental cells. Fusosomes were prepared as described previously in Examples 114 and 154.
[001936] [001936] This ratio is defined as the lipid content described in Example 49, and the nucleic acid content is determined as described in Example 50. As shown in Figure 48 and in the table below, fusosomes exhibit a higher lipid: DNA ratio than parental cells. E Tiipes [GM TIDNA (ol) | Upidos DNA Gorafia) EXAMPLE 160: ANALYZING SURFACE MARKERS IN FUSOSOMES
[001937] [001937] This test describes the identification of surface markers in fusosomes.
[001938] [001938] Fusosomes were prepared as described here in Examples 114 and 154. Phosphatidylserine was measured by mass spectrometry, as described here in Examples 114 and 154. The amount of phosphatidylserine in relation to the total lipids in the fusosomes was determined to be 121 % greater than the amount of phosphatidylserine in relation to the total lipid in the parental cells, as shown in the table below.
[001939] [001939] In this example, the composition of the sample preparation was analyzed and the proportion of proteins derived from sources of the viral capsid was evaluated.
[001940] [001940] Fusosomes were prepared as described herein by the method of Examples 114 and 154. Protein quantitation by
[001941] [001941] Using this approach, it was found that the sample contained 0.05% viral capsid protein, as shown in the table below. The only viral capsid protein detected was the endogenous rabbit lentivirus complex (RELIK) with cyclophilin A (PDB 2XGY | B). Po gross intensity of MS | ViralProtein Total (%) | EXAMPLE 162: QUANTIFICATION OF PROTEIN PROPORTIONS IN FUSOSGENS IN FUSOSOMES
[001942] [001942] This example describes the quantification of the ratio of fusogenic protein to total protein or other proteins of interest in fusosomes. Other proteins of interest may include, but are not limited to, EGFP, CD63, ARRDC1, GAPDH, Calnexin (CNX) and TSG101. Fusosomes were prepared as described here by the method of Examples 114 and 154. Quantification of proteins by mass spectrometry for fusosomes was performed as described here in Example 42. Quantification of all proteins was calculated as described here in Example 42, averaged the samples of fusosomes and expressed as a fraction.
[001943] [001943] As shown in the table below, it was found that the fusogen had an EGFP ratio of 156.9, a CD63 ratio of 2912.0, an ARRDC1 ratio of 664.9, a GAPDH ratio of 69, 0, a CNX ratio of 558.4 and a TSG101 ratio of 3064.1.
[001944] [001944] This example describes the quantification of an endogenous or synthetic protein load in relation to the total protein or other proteins of interest in fusosomes. Other proteins of interest may include, but are not limited to, VSV-G, CD63, ARRDC1, GAPDH, Calnexin (CNX) or TSG101. Fusosomes were prepared as described herein by the method of Examples 114 and 154. Quantification of proteins by mass spectrometry for fusosomes was performed as described here in Example 42. Quantification of all proteins was calculated as described here in Example 42, the fusosome samples are averaged and expressed as a fraction.
[001945] [001945] As shown in the table below, it was found that the synthetic protein load has a VSV-G ratio of 6.37 x 103, a CD63 ratio of 18.6, an AR-RDC1 ratio of 4, 24, a ratio for GAPDH of 0.44, one for CNX of 3.56 and for TSG101 of 19.52.
[001946] [001946] This example describes the quantification of the lipid composition of fusosomes, parental cells and exosomes. It is contemplated that the lipid composition of fusosomes can be enriched and / or depleted for specific lipids in relation to the cells from which they are derived. The lipid composition affects important biophysical parameters of fusosomes and cells, such as size, electrostatic interactions and colloidal behavior.
[001947] [001947] The lipid composition was measured as described in Examples 114 and 154. Fusosomes were prepared as described herein by transient transfection of VSV-G and GFP in 10 cm plates, followed by filtration and ultracentrifugation of the conditioned medium 48 hours after transfection to obtain fusosomes. The transfected cells were harvested in parallel to the conditioned medium and subjected to analysis. Exosomes were prepared as described here for fusosomes, with the exception that the parental cells were not transfected with VSV-G or GFP.
[001948] [001948] The lipid composition for fusosomes, exosomes and parental cells is shown in FIGURES 49A-49B. Compared to parental cells, fusosomes were enriched with cholesteryl ester, free cholesterol, ether-linked smooth-phosphatidylethanolamine, ether-linked smooth-phosphatidylserine, phosphatidylethanolamine, phosphatidylserine and sphingomyelin. Compared to parental cells,
[001949] [001949] This example describes the quantification of the proportion of proteins derived from specific cellular compartments in fososomes, parental cells, fusosomes and exosomes.
[001950] [001950] Fusosomes and parental cells were prepared as described herein by the method of Examples 114 and 154. Exosomes were prepared as described herein for fusosomes by the method of Examples 114 and 154, with the exception that the parental cells were not transfected with VSV-G or GFP. Quantification of proteins by mass spectrometry for fusosomes and exosomes was performed as described here in Example 42. The resulting protein quantification data was analyzed to determine protein levels and proportions of known exosomal proteins, endoplasmic reticulum, ribosome, nuclear and mitochondrial, as noted by the terms of the Gene Ontology cell compartment annotation (exosome: GO: 0070062, endoplasmic reticulum: GO: 0005783, rhisomeome: GO: 0005840, GO: 0022626, GO: 0022627, GO: 0022627, GO: 0044391, GO: 0042788, GO: 0000313) with the IDA evidence code (inferred by direct test). The fraction of specific proteins in the compartment in relation to the total protein in each sample was determined for samples of fusosomes, exosome samples and parental cells.
[001951] [001951] As shown in Figure 50, fusosomes have been found to be depleted with endoplasmic reticulum protein compared to parental cells and exosomes. Fusosomes have also been found to be depleted for exosomal protein compared to exosomes. Fusosomes were streaked for mitochondrial protein compared to parental cells. Fusosomes were enriched with nuclear protein compared to parental cells. Fusosomes have been enriched for ribosomal proteins compared to parental cells and exosomes. EXAMPLE 166: MEASURING THE CONTENT OF TSG101 AND ARRDC1 IN FUSOSOMES
[001952] [001952] This example describes the quantification of the proportion of proteins that are known to be important in the release of the fusosome by cells.
[001953] [001953] Fusosomes and parental cells were prepared as described here by the method of Examples 114 and 154. Exosomes were prepared as described herein for fusosomes by the method of Examples 114 and 154, with the exception that the parental cells were not transfected with VSV-G or GFP. Quantification of proteins by mass spectrometry for fusosomes and exosomes was performed as described here in Example 42. The data resulting from protein quantification were analyzed to determine the levels and proportions of TSG101 and ARRDC1 proteins. The average log intensities per group were calculated by adding 1 to the intensity values of the mass spectrometry, transforming by log10 and calculating the average between repetitions. The percentage of total protein content of TSG101 or ARRDC1 in fusosomes relative to exosomes or parental cells was determined as the mean logarithmic intensity of TSG101 or ARRDC1 for each sample, divided by the sum of the intensities of all proteins in the same sample, on average over repetitions and expressed as a percentage.
[001954] [001954] As shown in Figure 51, ARRDC1 was found to be present at higher levels as a percentage of the total protein content in fusosomes than in parental cells or exosomes. The level of ARRDC1 as a percentage of the total protein content was at least 0.02% in fusosomes. TSG101 was found to be present at higher levels as a percentage of the total protein content in fusosomes than in parental cells or exosomes. The TSG101 level as a percentage of the total protein content was at least 0.004% in fusosomes. EXAMPLE 167: MEASUREMENT OF PRE-EXISTING SERIC INACTIVATION TRY FUSOSOMES
[001955] [001955] This example describes the quantification of preexisting serum inactivation of fusosomes using an in vitro delivery assay.
[001956] [001956] A measure of immunogenicity for fusosomes is serum inactivation. Serum inactivation of fusosomes may be due to antibody-mediated neutralization or complement-mediated degradation. In one embodiment, some recipients of a spindle-sum described here will have factors in the serum that bind and inactivate fusosomes.
[001957] [001957] In this example, a virgin fusosome mouse is evaluated for the presence of factors that inactivate fusosomes in the serum. Notably, the methods described here can be equally applicable to humans, mice, monkeys with protocol optimization. The negative control is inactivated mouse serum.
[001958] [001958] Fusosomes are tested for the dose at which 50% of the cells in a recipient population receive the payload in the spindles. Fusosomes can be produced using any of the other examples described herein and can contain any of the payloads described herein. Many methods for testing the fossa delivery of a payload to recipient cells are also described here. In this particular example, the payload is the Cre protein and the recipient cells are RPMI8226 cell that stably expresses "LoxP-GFP-stop-LoxP-RFP" cassette under a CMV promoter, which after Cre recombination changes from GFP to RFP expression, indicating fusion and Cre, as a marker, of delivery. The identified dose in which 50% of the recipient cells are positive for RFP is used for other experiments. In other embodiments, the identified dose in which 50% of the recipient cells receive the payload is used for other experiments. In preferred embodiments, the identified dose at which 50% of recipient cells receive the payload is similar between fusosomes.
[001959] [001959] To assess serum inactivation of fusosomes, spindles are diluted 1: 5 in normal or heat-inactivated serum (or medium containing 10% heat-inactivated FBS as a serum-free control) and the mixture is incubated at 37ºC for 1 h. After incubation, the medium is added to the reaction for an additional 1: 5 dilution and then
[001960] [001960] Fusosomes that were exposed to the serum are then incubated with recipient cells. The percentage of cells that receive the payload and are therefore positive for the RFP is calculated. In some modalities, the percentage of cells that receive the payload is not different between fusosome samples that were incubated with serum and serum inactivated by the heat of virgin fusosome mice, indicating that there is no serum inactivation of fusosomes. In some modalities, the percentage of cells receiving the payload is no different between fusosome samples that were incubated with serum from fusosome virgin mice and control incubations without serum, indicating that there is no serum fusosome inactivation. In some modalities, the percentage of cells that receive the payload is lower in fusosome samples that were incubated with positive control serum than in fusosome samples that were incubated with serum from virgin fusosome mice, indicating that there is no serum fusosome inactivation .
[001961] [001961] This example describes the quantification of serum inactivation of fusosomes using an in vitro delivery assay after several administrations of the fusosome. It is contemplated that a modified fusosome, for example, modified by a method described here, may have reduced serum inactivation (for example, reduced compared to the administration of an unmodified fusosome) after multiple (for example , more than one, for example, 2 or more), modified fusosome administrations. In some cases, a fusosome described here will not be inactivated by the serum after multiple administrations.
[001962] [001962] A measure of immunogenicity for fusosomes is serum inactivation. In one embodiment, repeated injections of a fososome can lead to the development of anti-fusosome antibodies, for example, antibodies that recognize fusosomes. In one embodiment, antibodies that recognize fusosomes can bind in a way that can limit the activity or remoteness of the fusosome and mediate complement degradation.
[001963] [001963] In this example, serum inactivation is examined after one or more administrations of fusosomes. Fusosomes are produced by any of the previous examples. In this example, spindle-sums are generated from: HEK293 cells modified with a lentiviral-mediated expression of HLA-G (hereinafter, HEK293- HLA-G), and HEK293 modified with a lentiviral-mediated expression of a vector empty (hereafter, HEK293). In some modalities, fusosomes are derived from cells that express other immunoregulatory proteins.
[001964] [001964] Serum is collected from different cohorts: mice injected systemically and / or locally with 1, 2, 3, 5, 10 vehicle injections (Fusosome virgin group), HEK293-HLA-G fusosomes or HEK293 fusosomes. Serums are collected from the collecting mice by collecting fresh whole blood and allowing complete clotting for several hours. The clots are granulated by centrifugation and the serum supernatants are removed. A negative control is mouse serum inactivated by heat. The negative control samples are heated to 56 degrees Celsius for 1 hour. The serum can be frozen in aliquots.
[001965] [001965] Fusosomes are tested for the dose in which 50% of the cells in a recipient population receive the payload in the spindles. Fusosomes can be produced using any of the other examples described herein and can contain any of the payloads described herein. Many methods for testing the fossa delivery of a payload to recipient cells are also described here. In this particular example, the payload is the Cre protein and the recipient cells are RPMI8226 cell that stably expresses "LoxP-GFP-stop-LoxP-RFP" cassette under a CMV promoter, which after Cre recombination changes from GFP to RFP expression, indicating fusion and Cre, as a marker, of delivery. The identified dose in which 50% of the recipient cells are positive for RFP is used for other experiments. In other embodiments, the identified dose in which 50% of the recipient cells receive the payload is used for other experiments.
[001966] [001966] To assess serum inactivation of fusosomes, spindles are diluted 1: 5 in normal or heat inactivated serum (or medium containing 10% heat-inactivated FBS as a serum-free control) and the mixture is incubated at 37ºC for 1 h. After incubation, the medium is added to the reaction for an additional 1: 5 dilution and then serially diluted twice in a 1:10 ratio. After this step, the fusosomes must be present in the dose previously identified in which 50% of the recipient cells received the payload (for example, they are positive for RFP). It is contemplated that the identified dose in which 50% of the recipient cells receive the payload may be similar between fusosomes.
[001967] [001967] Fusosomes that were exposed to the serum are then incubated with recipient cells. The percentage of cells that receive the payload and are therefore positive for the RFP is calculated. The percentage of cells that receive the payload may not be different between fusosome samples that were incubated with serum and heat-inactivated serum from mice treated with HEK293-HLA-G fusosomes, indicating that there is no serum inactivation of fusosomes or a system. -
[001968] [001968] This example describes the quantification of complement activity against fusosomes using an in vitro assay. It is contemplated that a modified fusosome described herein can induce reduced complement activity compared to a corresponding unmodified fusosome.
[001969] [001969] In this example, the serum of a mouse is assessed for complement activity against a fusosome. The example measures the level of complement C3a, which is a central node in all complement pathways. Notably, the methods described here can be equally applicable to humans, mice, and macaques with optimization for the protocol.
[001970] [001970] In this example, fusosome uses are produced by any of the Examples above. Fusosomes are
[001971] [001971] Serum is recovered from virgin mice, mice that are administered HEK293-DAF fusosomes or mice that are administered HEK293 fusosomes. Serums are collected from the collecting mice by collecting fresh whole blood and allowing complete clotting for several hours. Clots are pelleted by centrifugation and serum supernatants are removed. A negative control is heat-inactivated mouse serum. The negative control samples are heated to 56 degrees Celsius for 1 hour. The serum can be frozen in aliquots.
[001972] [001972] The different fusosomes are tested for the dose at which 50% of the cells in a recipient population receive the payload in the fusosomes. Fusosomes can be produced using any of the other examples described here and can contain any of the payloads described here. Many methods for testing the fusosomal delivery of a payload to recipient cells are also described here. In this particular example, the payload is Cre protein and the recipient cells are RPMI8226 cells that
[001973] [001973] Double dilutions of fusosomes from the spindle-dose dose in which 50% of the recipient cells receive the payload in phosphate buffered saline (PBS, pH 7.4) are mixed with a 1:10 dilution of the sera of mice treated with the same fusosomes or virgin mice (test volume, 20 µl) and incubated for 1 h at 37ºC. The samples are then diluted 1: 500 and used in an enzyme-linked immunosorbent assay (ELISA) specific for C3a. The ELISA is the LS-F4210 product from the mouse complement C3a ELISA kit sold by LifeSpan BioSciences Inc, which measures the concentration of C3a in a sample. The dose of fusosomes in which 200 pg / ml of C3a are present is compared between sera isolated from mice.
[001974] [001974] In some cases, the dose of fusosomes in which 200 pg / ml of C3a is present is higher for HEK293-DAF fusosomes incubated with HEK-293 DAF serums than for HEK293 fusosomes incubated with HEK293 mouse serums , indicating that complement activity directed at fusosomes is greater in mice treated with HEK293 fusosomes than in HEK293-DAF fusosomes. In some cases, the dose of fososomes in which 200 pg / ml of C3a is present is higher for HEK293-DAF fusosomes incubated with sera from viruses
[001975] [001975] This example describes the use of protein 1 that contains the curtain domain (ARRDC1) in the fusosome production protocol and describes the effects of AARDC1 on the number of fusosomes and the delivery of Cre by the resulting fusosomes. Fusosomes encapsulating Cre were generated by the standard procedure for harvesting and preparing fusosomes produced from HEK-293T cells that express the glycoproteins of the Nipah (NiV-G) and fusion (NiV-F) envelope on the surface bacteriophage P1 Cre recombinase and the ARRDC1 protein. Control fusosomes were produced from HEK-293T cells that express only Cre and the glycoproteins NIV-G and NiV-F. The effects of ARRDC1 on the ability of the fusosomes to provide the Cre number and the fusosome were then determined as follows.
[001976] [001976] HEK-293T receptor cells designed to express a "LoxP-GFP-stop-LoxP-RFP" cassette were plated
[001977] [001977] To quantify the extent to which Cre delivery was enhanced by incorporating ARRDC1 into the production protocol, a group of recipient cells was treated with fusosomes produced from cells transfected with ARRDC1 (NIV-G + NIV-F + NLS-
[001978] [001978] After adding Hoescht, the cells were analyzed by flow cytometry. Briefly, samples of receiving cells were dissociated, collected and washed three times with 1xPBS buffer and resuspended in 1xPBS buffer and analyzed by flow cytometry (Attune, ThermoFisher) using 405 nm, 488 nm and 561 nm lasers for excitation and the 440 / 50BP (Hoescht), 530 / 380BP (GFP) and 585 / 16BP (RFP) emission filter sets for purchase, reception. The Attune NxT software was used for acquisition and the FlowJo software was used for analysis. For data acquisition and analysis, the FSC and SSC channels were defined on a linear axis to determine a representative population of recipient cells. This population was then closed and a minimum of 10,000 events inside the cell door were collected for each condition. A representative population of recipient cells in the Hoescht emission channel (440 / 50BP) was then blocked, and this port was used to display GFP events (530 / 30BP). A population representative of the GFP + receptor cells was then closed and this door was used to display RFP events (585 / 16BP). The positive cells for RFP (recipient cells that receive Cre) were then quantified as a metric for the delivery of Cre, first establishing a negative port based on untreated cells and a positive port based on positive RFP cells. treated with Cre recombinase gesicles. At the highest dose, Cre-loaded fusosomes produced from cells transfected with ARRDC1 showed an observable level of Cre delivery corresponding to 9.2% of RFP positive cells out of the total GFP positive receptor cells ( Figure 52A). However, in the absence of ARRDC1, Cre delivery was substantially reduced, with a delivery level corresponding to 1.8% RFP positive cells (Figure 52A). The untreated recipient cells did not show appreciable RFP positive cells. Taken together, these data illustrate ARRDC1's ability to improve Cre delivery based on the fusosome.
[001979] [001979] Using fluorescent nanoparticles Monitoring Analysis (fNTA), fusosomes produced from cells transfected with ARRDC1 exhibited a concentration of 2.8x10 'particles / ml, whereas fusosomes produced in the absence of ARRDC1, exhibited a concentration of 1 , 2x10 * 'particles / ml! (Figure 52B), demonstrating that the presence of ARRDC1 in the producing cells leads to the production of more CellMask Orange + particles (fNTA).

权利要求:
Claims (53)
[1]
1. Fusosome composition characterized by the fact that it comprises a plurality of fusosomes derived from a cell of origin, in which the fusosomes of the plurality comprise: (a) a lipid bilayer, (b) a lumen comprising cytosol, in which the lumen is surrounded by the lipid bilayer; (c) an exogenous or overexpressed fusogen disposed in the lipid bilayer, (d) a charge; and wherein the fusosome does not comprise a nucleus; wherein the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein; where the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a population of reference target cells not treated with the endocytosis inhibitor, delivers the charge to at least 30% of the number of cells in the target cell population compared to the target target cell population or delivers at least 30% more of the load to the target cell population compared to the target cell population reference target.
[2]
2. Fusosome composition according to claim 1, characterized by the fact that it delivers the charge to at least 40%, 50%, 60%, 70% or 80% of the number of cells in the target cell population compared to the target cell population of reference or delivery at least 40%, 50%, 60%, 70% or 80% more of the load to the target cell population compared to the cell population reference target.
[3]
3. Fusosome composition according to claim
tion 1 or 2, characterized by the fact that less than 10% of the charge enters the cell by endocytosis.
[4]
Fusosome composition according to any one of the preceding claims, characterized in that the endocytosis inhibitor is an inhibitor of lysosomal acidification, for example, bafilomycin A1.
[5]
Fusosome composition according to any one of the preceding claims, characterized in that the delivered charge is determined using an endo-cytosis inhibition assay, for example, an Example 135 assay.
[6]
6. Fusosome composition according to any one of the preceding claims, characterized by the fact that the charge enters the cell via a dinamine-independent pathway or an independent lysosomal acidification pathway, a macropinocytosis-independent pathway or a pathway actin-independent.
[7]
Fusosome composition according to any one of the preceding claims, characterized in that the fusosomes of the plurality additionally comprise a targeting chemical moiety.
[8]
8. Fusosome composition, according to claim 7, characterized by the fact that the chemical targeting portion is composed of fusogen or is composed of a separate molecule.
[9]
Fusosome composition according to any one of the preceding claims, characterized by the fact that when the plurality of fusosomes is brought into contact with a population of cells comprising target cells and non-target cells, the charge is present in at least 10 times more target cells than non-target cells, or at least 10 times more of the charge is present in the target cell population compared to the reference target cell population.
[10]
10. Fusosome composition according to any one of the preceding claims, characterized in that the fusosomes of the plurality fuse at a higher rate with a target cell than with a non-target cell or reference cell in at least 50%.
[11]
11. Fusosome composition characterized by the fact that it comprises a plurality of fusosomes derived from a cell of origin, and in which the fusosomes of the plurality comprise: (a) a lipid bilayer, (b) a lumen comprising cytosol, in that the lumen is surrounded by the lipid bilayer; (c) an exogenous redirected or overexpressed fusogen disposed in the lipid bilayer; (d) a charge; and wherein the fusosome does not comprise a nucleus; wherein the amount of viral capsid protein in the fusosome composition is less than 1% of the total protein; where: (i) when the plurality of fusosomes are brought into contact with a population of cells comprising target cells and non-target cells, the charge is present in at least 10 times more target cells than non-target cells or reference cells, or (ii) fusosomes of the plurality fuse at a higher rate with a target cell than with a non-target cell or reference cell by at least 50%.
[12]
12. Fusosome composition according to claim 11, characterized by the fact that the presence of charge is measured by microscopy, for example, using an Example 124 assay.
[13]
13. Fusosome composition according to claim 11, characterized in that the fusion is measured by microscopy, for example, using an Example 54 assay.
[14]
14. Fusosome composition according to any of claims 7 to 13, characterized by the fact that the targeting chemical moiety is specific for a cell surface marker on the target cell.
[15]
15. Fusosome composition according to claim 14, characterized in that the cell surface marker is a cell surface marker of a skin cell, of cardiomyocytes, hepatocyte, intestinal cell (for example, small intestine cells), pancreatic cells, brain cells, prostate cells, lung cells, colon cells or bone marrow cells.
[16]
16. Fusosome composition according to any of claims 11 to 15, characterized by the fact that fumogen (eg, redirected fusogen) comprises a rhabdoviridae fusion (eg VSV-G), a fusogen of filoviridae, a fusogen of arenaviridae, a fusogen of togaviridae, a fusogen of flaviviridae, a fusogen of bunyaviridae or a fujigen of hapadnaviridae (for example, Hep B) or a derivative thereof.
[17]
17. Fusosome composition according to any one of claims 7 to 16, characterized by the fact that the plurality of fusosomes, when in contact with a population of target cells in the presence of an endocytosis inhibitor, and when in contact with a reference target cell population not treated with the endocytosis inhibitor, it delivers the charge to at least 30% of the number of cells in the target cell population compared to the reference target cell population.
[18]
18. Fusosome composition according to any one of the preceding claims, characterized by the fact that, when in contact with a target cell population, it delivers charge to a target cell location with the exception of an endosome or smooth-sum , for example, for cytosol.
[19]
19. Fusosome composition according to claim 18, characterized by the fact that 50%, 40%, 30%, 20% or 10% less of the cargo is delivered to an endosome or lysosome.
[20]
20. Fusosome composition according to any one of the preceding claims, characterized in that the amount of viral capsid protein in the fusosome composition is determined using mass spectrometry, for example, using an Example 53 assay.
[21]
21. Fusosome composition according to any one of the preceding claims, characterized by the fact that plurality fusosomes comprise exosomes, microvesicles or a combination thereof.
[22]
22. Fusosome composition according to any one of the preceding claims, characterized by the fact that the plurality of fusosomes has an average size of at least 50 nm, 100 nm, 200 nm, 500 nm, 1,000 nm, 1,200 nm, 1,400 nm or 1,500 nm.
[23]
23. Fusosome composition according to any one of claims 1 to 21, characterized in that the plurality of fusosomes has an average size of less than 100 nm, 80 nm, 60 nm, 40 nm or 30 nm.
[24]
24. Fusosome composition according to any one of the preceding claims, characterized by the fact that the source cell is selected from a neutrophil, a HEK293 cell, a granulocyte, a mesenchymal stem cell, a stem cell
bone marrow stem, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, a myoblast, a hepatocyte or a neuron, for example, neuronal retinal cell.
[25]
25. Fusosome composition according to any one of the preceding claims, characterized by the fact that the plurality of fusosomes comprise cytobiologicals.
[26]
26. Fusosome composition according to any one of the preceding claims, characterized in that the plurality of fusosomes comprise enucleated cells.
[27]
27. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusogen (for example, redirected fusogen) comprises mammalian fumogen.
[28]
28. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusogen (eg, redirected fusogen) comprises a viral fusogen.
[29]
29. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusogen (eg, redirected fusogen) is active at a pH of 4-5.5a6.6a7.7a8.8a9or9gal10.
[30]
30. Fusosome composition according to any of the preceding claims, characterized by the fact that fusogen (eg, redirected fusogen) is not active at a pH of 4-5.5a6.6a7.7a8.8a9or9gallo.
[31]
31. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusogen (eg, redirected fusogen) is a prosthetic fusogen.
[32]
32. Fusosome composition according to any one of the preceding claims, characterized by the fact that the fusogen (for example, redirected fusogen) comprises a sequence chosen from a Nipah virus F protein, a measles virus F protein , a protein F of the paramyxovirus tupaia, a protein F of the paramixovirus, a protein F of the Hadrian virus, a protein F of the hipavirus, a protein F of the morbilivirus, a protein F of the respirovirus, a protein F of the Sendai virus, a rubulavirus F protein or an avulavirus F protein or a derivative thereof.
[33]
33. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusogen is present in a number of copies of at least 10 copies per fusosome.
[34]
34. Fusosome composition according to any one of the preceding claims, characterized by the fact that fusosomes in plurality additionally comprise a G protein from the Nipah virus, a H protein from measles, a H protein from tupaia-paramixovirus, a paramyxovirus G protein, paramyxovirus H protein, paramyxovirus HN protein, morbilivitus H protein, respirovirus HN protein, sendai virus HN protein, rubulavirus HN protein, avulavirus HN protein or a derivative of the same.
[35]
35. Fusosome composition according to any one of the preceding claims, characterized by the fact that the fusogen (for example, redirected fusogen) comprises a sequence chosen from the F and G proteins of the Nipah virus, the F and H proteins of the measles viruses, paramyxovirus tupaia F and H proteins, paramyxovirus F and G proteins or F and H proteins or F and HN proteins, Hendra virus F and G proteins, Henipavirus F and G proteins, F proteins and H of Morbilivirus, proteins F and HN of respirovirus,
proteins F and HN of the Sendai virus, proteins F and HN of the rubulavirus or proteins F and HN of the avulavirus or derivative or any combination thereof.
[36]
36. Fusosome composition according to any one of the preceding claims, characterized in that the charge comprises an exogenous protein or an exogenous nucleic acid.
[37]
37. Fusosome composition according to any one of the preceding claims, characterized in that the charge comprises or encodes a cytosolic protein or a membrane protein.
[38]
38. Fusosome composition according to any one of the preceding claims, characterized in that the charge comprises a therapeutic agent.
[39]
39. Fusosome composition according to any one of the preceding claims, characterized by the fact that the charge is present in a number of copies of at least 1,2, 5, 10, 20, 50, 100 or 200 copies per fusosome (for example, up to about 1,000 copies per fusosome).
[40]
40. Fusosome composition according to any one of the preceding claims, characterized by the fact that the ratio of the number of copies of the fusogen (for example, redirected fusogen) to the number of copies of the charge is between 1,000: 1 and 1: 1, between 500: 1 and 1: 1, between 250: 1 and 1: 1, between 150: 1 and 1: 1, between 100: 1 and 1: 1, between 75: 1 and 1: 1, between 50: 1 and 1: 1, between 25: 1 and 1: 1, between 20: 1 and 1: 1, between 15: 1 and 1: 1, between 10: 1 and 1: 1, between 5: 1 and 1 : 1, between 2: 1 and 1: 1 or between 1: 1 and 1: 2.
[41]
41. Fusosome composition according to any one of the preceding claims, characterized by the fact that one or more of:
a) the fusosome composition has a fusogen ratio for CD63 of about 100 to 10,000, 500 to 5,000, 1,000 to 5,000,
2,000 to 4,000, 2,500 to 3,500, 2,900 to 2,930, 2,910 to 2,915 or 2,912.0, for example, by a mass spectrometry test; or b) the fusosome composition has a protein to CD63 charge ratio of about 5 to 35, 10 to 30, 15 to 25, 16 to 19, 18 to 19 or 18.6; or c) less than 15%, 20% or 25% of the protein in the fusosome is exosomal protein.
[42]
42. Fusosome composition according to any one of the preceding claims, characterized by the fact that one or more of: a) ofusogen comprises about 1 to 30%, 5 to 20%, 10 to 15%, 12 to 15% , 13 to 14% or 13.6% of the total protein in a spindle-sum, for example, by a mass spectrometry assay; b) fusogen has a GAPDH ratio of about 20 to 120, 40 to 100, 50 to 90, 60 to 80, 65 to 75, 68 to 70 or 69, for example, by a mass spectrometry assay; c) fusogen has a CNX ratio of about 200 to 900, 300 to 800, 400 to 700, 500 to 600, 520 to 590, 530 to 580, 540 to 570, 550 to 560 or 558.4, for example, by a mass spectrometry test; d) at 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% of the protein in the fusosome is ribosomal protein or about 1% to 20%, 3% at 15%, 5% to 12.5%, 7.5% to 11% or 8.5% to 10.5% or 9% to 10% of the protein in the fusosome is the ribosomal protein.
[43]
43. Fusosome composition, according to any one of the preceding claims, characterized by the fact that: a) it meets a pharmaceutical standard or good manufacturing practices (GMP);
b) was made in accordance with good manufacturing practices (GMP); c) it has a pathogen level below a predetermined reference value, for example, it is substantially free of pathogens; or d) it has a contaminant level below a predetermined reference value, for example, it is substantially free of contaminants.
[44]
44. Fusosome composition according to any one of the preceding claims, characterized by the fact that it is below 4, 0, -4, -10, -12, -16, -20, -80 or -160 ºC.
[45]
45. Pharmaceutical composition characterized by the fact that it comprises the fusosome composition, as defined in any of the preceding claims, and a pharmaceutically acceptable carrier.
[46]
46. Pharmaceutical composition according to claim 45, characterized by the fact that the cargo comprises a therapeutic agent.
[47]
47. Method for delivering a therapeutic agent to a subject characterized by the fact that it comprises administering to the subject a pharmaceutical composition, as defined in claim 46, wherein the fusosome composition is administered in an amount and / or time such that the therapeutic agent is delivered.
[48]
48. Method for making a fusosome composition characterized by the fact that it comprises: a) providing a fusosome composition, as defined in any one of claims 1 to 44; and b) formulating fusosomes as a pharmaceutical composition suitable for administration to a subject.
[49]
49. Method for making a fusosome composition characterized by the fact that it comprises: a) providing a fusosome composition, as defined in any one of claims 1 to 44; and b) testing one or more fusosomes of the plurality to determine the presence or level of one or more of the following factors: (i) an immunogenic molecule; (ii) a pathogen; or (ili) a contaminant; and c) approve the plurality of fusosomes or fusosome composition for release if one or more of the factors is below a reference value.
[50]
50. Fusosome composition characterized by the fact that it comprises a plurality of fusosomes derived from a cell of origin, and in which the fusosomes of the plurality comprise: (a) a lipid bilayer, (b) a lumen surrounded by the lipid bilayer; (c) an exogenous or overexpressed fusogen, in which the fusion is arranged in the lipid bilayer; and (d) a charge; wherein the fusosome does not comprise a nucleus; and where one or more of (for example, at least 2, 3, 4 or 5 of): viii) fusogen is present in a number of copies of at least 1,000 copies; ix) the fusosome comprises a therapeutic agent with a copy number of at least 1,000 copies; x) the fusosome comprises a lipid in which one or more of CL, Cer, DAG, HexCer, LPA, LPC, LPE, LPG, LPI, LPS, PA, PC, PE, PG, PI, PS, CE, SM and TAG they are within 75% of the corresponding lipid level in the source cell; Fusosome cheese comprises a proteomic composition similar to that of the source cell; xii) the fusosome is capable of signal transduction, for example, transmitting an extracellular signal, for example, phosphorylation of AKT in response to insulin or glucose uptake (for example, marked glucose, for example, 2-NBDG) in insulin response, for example, at least 10% more than a negative control, for example, a similar spindle sum in the absence of insulin; xiii)> the fusosome targets a tissue, for example, liver, lungs, heart, spleen, pancreas, gastrointestinal tract, kidney, testicles, ovaries, brain, reproductive organs, central nervous system, peripheral nervous system, skeletal muscle, endothelium, internal ear or eye, when administered to a subject, for example, a mouse, for example, in which at least 0.1% or 10% of the spindles in a population of administered fusosomes they are present in the target tissue after 24 hours; or xiv) the source cell is selected from a neutrophil, a granulocyte, a mesenchymal stem cell, a bone marrow stem cell, an induced pluripotent stem cell, an embryonic stem cell, a myeloblast, a myoblast, a hepatocyte or a neuron, for example, neuronal retinal cell.
[51]
51. Fusosome composition according to claim 50, characterized by the fact that it comprises a viral capsid protein or a DNA integrating polypeptide.
[52]
52. Fusosome composition according to claim 50, characterized by the fact that the load comprises a viral genome.
[53]
53. Fusosome composition according to claim 50, characterized in that it is capable of delivering a nucleic acid to a target cell, for example, to stably modify the target cell's genome, for example, to gene therapy.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112019023323A2|2020-07-21|compositions to facilitate membrane fusion and uses thereof

---

US20210187018A1|2021-06-24|Cytobiologics and therapeutic uses thereof

---

JP2021513849A|2021-06-03|Compositions and Methods for Membrane Protein Delivery

---

KR20210043574A|2021-04-21|Fusosome composition and use thereof

---

KR20210131991A|2021-11-03|Compositions and methods for compartment-specific cargo delivery

---

IL283179D0|2021-06-30|Fusosome compositions for cns delivery

---

JP2022507453A|2022-01-18|Fusosome composition for T cell delivery

---

EP3880832A1|2021-09-22|Fusosome compositions for hematopoietic stem cell delivery

同族专利:

---

公开号 | 公开日

---

US20200060980A1|2020-02-27|

---

KR20200034668A|2020-03-31|

---

WO2018208728A1|2018-11-15|

---

AU2018266111A1|2019-11-21|

---

EP3622079A1|2020-03-18|

---

CN110869507A|2020-03-06|

---

CA3062426A1|2018-11-15|

---

JP2020519648A|2020-07-02|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

AU2589095A|1994-05-16|1995-12-05|Washington University|Cell membrane fusion composition and method|

---

WO1999013905A1|1997-09-18|1999-03-25|The Trustees Of The University Of Pennsylvania|Receptor-binding pocket mutants of influenza a virus hemagglutinin for use in targeted gene delivery|

---

US6693086B1|1998-06-25|2004-02-17|National Jewish Medical And Research Center|Systemic immune activation method using nucleic acid-lipid complexes|

---

US20040028687A1|2002-01-15|2004-02-12|Waelti Ernst Rudolf|Methods and compositions for the targeted delivery of therapeutic substances to specific cells and tissues|

---

CA2479763A1|2002-03-27|2003-10-09|Baylor College Of Medicine|Potent oncolytic herpes simplex virus for cancer therapy|

---

DE60334618D1|2002-06-28|2010-12-02|Protiva Biotherapeutics Inc|METHOD AND DEVICE FOR PREPARING LIPOSOMES|

---

PL377161A1|2002-11-21|2006-01-23|Pevion Biotech Ltd.|High-efficiency fusogenic vesicles, methods of producing them, and pharmaceutical compositions containing them|

---

KR101168440B1|2003-07-16|2012-07-27|프로티바 바이오쎄라퓨틱스, 인코포레이티드|Lipid encapsulated interfering rna|

---

NZ581166A|2003-09-15|2011-06-30|Protiva Biotherapeutics Inc|Polyethyleneglycol-modified lipid compounds and uses thereof|

---

US7842673B2|2003-12-17|2010-11-30|The Trustees Of Columbia University In The City Of New York|Delivery of DNA or RNA via gap junctions from host cells to target cells and a cell-based delivery system for antisense or siRNA|

---

CA2569664C|2004-06-07|2013-07-16|Protiva Biotherapeutics, Inc.|Lipid encapsulated interfering rna|

---

EP1781593B1|2004-06-07|2011-12-14|Protiva Biotherapeutics Inc.|Cationic lipids and methods of use|

---

AU2005326322B2|2004-07-01|2009-02-05|Yale University|Targeted and high density drug loaded polymeric materials|

---

US20060045910A1|2004-09-02|2006-03-02|Ehringer William D|Preserved fusogenic vesicles|

---

WO2006027202A1|2004-09-06|2006-03-16|Unite De Recherche En Biotherapie Et Oncologie |Generation of multiparent cell hybrids|

---

GB0426641D0|2004-12-03|2005-01-05|Bioactive Protein Delivery The|Protein delivery system|

---

WO2007048046A2|2005-10-20|2007-04-26|Protiva Biotherapeutics, Inc.|Sirna silencing of filovirus gene expression|

---

JP5336853B2|2005-11-02|2013-11-06|プロチババイオセラピューティクスインコーポレイティッド|Modified siRNA molecules and methods of use thereof|

---

WO2007099387A1|2006-03-03|2007-09-07|Mymetics Corporation|Virosome-like vesicles comprising gp41-derived antigens|

---

US9085778B2|2006-05-03|2015-07-21|VL27, Inc.|Exosome transfer of nucleic acids to cells|

---

US7915399B2|2006-06-09|2011-03-29|Protiva Biotherapeutics, Inc.|Modified siRNA molecules and uses thereof|

---

US8058069B2|2008-04-15|2011-11-15|Protiva Biotherapeutics, Inc.|Lipid formulations for nucleic acid delivery|

---

ES2613498T3|2009-07-01|2017-05-24|Protiva Biotherapeutics Inc.|New lipid formulations for the delivery of therapeutic agents to solid tumors|

---

US8236943B2|2009-07-01|2012-08-07|Protiva Biotherapeutics, Inc.|Compositions and methods for silencing apolipoprotein B|

---

WO2011024172A2|2009-08-27|2011-03-03|Technion Research & Development Foundation Ltd.|Liposomal compositions and uses of same|

---

EP2498823B1|2009-11-13|2018-08-29|INSERM - Institut National de la Santé et de la Recherche Médicale|Direct protein delivery with engineered microvesicles|

---

CN103687590A|2011-04-28|2014-03-26|Stc·Unm公司|Porous nanoparticle-supported lipid bilayers for targeted delivery and methods of using same|

---

WO2013119602A1|2012-02-06|2013-08-15|President And Fellows Of Harvard College|Arrdc1-mediated microvesicles and uses thereof|

---

EP2920306B1|2012-11-13|2018-06-27|Codiak BioSciences, Inc.|Delivery of therapeutic agent|

---

CA2905229A1|2013-06-11|2014-12-18|Clontech Laboratories, Inc.|Protein enriched microvesicles and methods of making and using the same|

---

CN112870163A|2014-01-21|2021-06-01|安杰瑞姆生物科学公司|Hybrid, composition containing the hybrid, preparation method and use thereof|

---

US9816080B2|2014-10-31|2017-11-14|President And Fellows Of Harvard College|Delivery of CAS9 via ARRDC1-mediated microvesicles |

---

WO2016077639A2|2014-11-12|2016-05-19|VL27, Inc.|Nanovesicular therapies|

---

WO2016138525A1|2015-02-27|2016-09-01|University Of Washington|Polypeptide assemblies and methods for the production thereof|

---

US20180135012A1|2015-05-13|2018-05-17|Rubius Therapeutics, Inc.|Membrane-receiver complex therapeutics|

---

US10624849B2|2015-09-28|2020-04-21|Northwestern University|Targeted extracellular vesicles comprising membrane proteins with engineered glycosylation sites|

---

US20170112773A1|2015-10-23|2017-04-27|Board Of Regents, The University Of Texas System|Plasma membrane vesicles comprising functional transmembrane proteins|

---

EP3389700B1|2015-12-17|2020-11-04|The Penn State Research Foundation|Paramyxovirus virus-like particles as protein delivery vehicles|

---

JP2019513019A|2016-03-15|2019-05-23|コディアック バイオサイエンシズ インコーポレイテッド|Therapeutic membrane vesicles|US10960071B2|2017-08-07|2021-03-30|The Regents Of The University Of California|Platform for generating safe cell therapeutics|

---

GB2597623A|2017-08-07|2022-02-02|Univ California|Platform for generating safe cell therapeutics|

---

WO2019113512A1|2017-12-07|2019-06-13|Flagship Pioneering Innovations V, Inc.|Cytobiologics and therapeutic uses thereof|

---

BR112020016570A2|2018-02-17|2020-12-15|Flagship Pioneering Innovations V, Inc.|COMPOSITIONS AND METHODS FOR MEMBRANE PROTEIN RELEASE|

---

EP3820509A1|2018-07-09|2021-05-19|Flagship Pioneering Innovations V, Inc.|Fusosome compositions and uses thereof|

---

US11166996B2|2018-12-12|2021-11-09|Flagship Pioneering Innovations V, Inc.|Anellovirus compositions and methods of use|

---

CA3125567A1|2019-01-18|2020-07-23|Flagship Pioneering, Inc.|Trem compositions and uses thereof|

---

KR20210135265A|2019-03-04|2021-11-12|플래그쉽 파이어니어링 이노베이션스 브이아이, 엘엘씨|Circular polyribonucleotides and pharmaceutical compositions thereof|

---

EP3946466A2|2019-03-25|2022-02-09|Flagship Pioneering Innovations VI, LLC|Compositions comprising modified circular polyribonucleotides and uses thereof|

---

WO2020219713A1|2019-04-23|2020-10-29|Case Western Reserve University|Fusogenic particles and related methods for delivering therapeutic agents to cells|

---

AU2020267758A1|2019-05-06|2021-11-25|Thomas MALCOLM|Tailored hypoimmune nanovesicular delivery systems for cancer tumors|

---

WO2020243560A1|2019-05-31|2020-12-03|Flagship Pioneering, Inc.|Uses of trem compositions to modulate trna pools|

---

CA3140205A1|2019-06-14|2020-12-17|Alexandra Sophie DE BOER|Circular rnas for cellular therapy|

---

WO2020257730A1|2019-06-19|2020-12-24|Flagship Pioneering Innovations Vi, Llc|Compositions comprising circular polyribonucleotides for protein modulation and uses thereof|

---

WO2021046143A1|2019-09-03|2021-03-11|Sana Biotechnology, Inc.|Cd24-associated particles and related methods and uses thereof|

---

WO2021062196A1|2019-09-26|2021-04-01|President And Fellows Of Harvard College|Minimal arrestin domain containing protein 1constructs|

---

WO2021092073A1|2019-11-04|2021-05-14|Flagship Pioneering, Inc.|Methods of modifying a nucleic acid sequence|

---

WO2021092064A1|2019-11-04|2021-05-14|Flagship Pioneering, Inc.|Trem compositions for con-rare codons and related uses|

---

CN111019882A|2019-12-10|2020-04-17|沈阳朗森特医疗器械有限公司|Separation and purification method of skin epidermal stem cell exosomes|

---

WO2021155171A1|2020-01-29|2021-08-05|Flagship Pioneering Innovations Vi, Llc|Delivery of compositions comprising circular polyribonucleotides|

---

WO2021155175A1|2020-01-29|2021-08-05|Flagship Pioneering Innovations Vi, Llc|Compositions for translation and methods of use thereof|

---

WO2021155177A1|2020-01-29|2021-08-05|Flagship Pioneering Innovations Vi, Llc|Compositions comprising linear polyribonucleotides for protein modulation and uses thereof|

---

WO2021236930A1|2020-05-20|2021-11-25|Flagship Pioneering Innovations Vi, Llc|Immunogenic compositions and uses thereof|

---

WO2021236980A1|2020-05-20|2021-11-25|Flagship Pioneering Innovations Vi, Llc|Coronavirus antigen compositions and their uses|

---

WO2021236952A1|2020-05-20|2021-11-25|Flagship Pioneering, Inc.|Compositions and methods for producing human polyclonal antibodies|

---

WO2021243290A1|2020-05-29|2021-12-02|Flagship Pioneering Innovations Vi, Llc|Trem compositions and methods relating thereto|

---

WO2021243301A2|2020-05-29|2021-12-02|Flagship Pioneering Innovations Vi, Llc.|Trem compositions and methods relating thereto|

---

WO2021262799A1|2020-06-23|2021-12-30|Flagship Pioneering, Inc.|Anti-viral compounds and methods of using same|

---

WO2022010889A1|2020-07-06|2022-01-13|Flagship Pioneering Innovations V, Inc.|Methods and compositions for producing viral fusosomes|

---

CN113262212A|2021-04-26|2021-08-17|北京大学口腔医学院|Cell membrane microvesicle targeting inflammatory region and application thereof|

法律状态:
2021-11-03| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762502998P| true| 2017-05-08|2017-05-08|

---

US62/502,998|2017-05-08|

---

US201762575147P| true| 2017-10-20|2017-10-20|

---

US62/575,147|2017-10-20|

---

US201762595862P| true| 2017-12-07|2017-12-07|

---

US62/595,862|2017-12-07|

---

PCT/US2018/031515|WO2018208728A1|2017-05-08|2018-05-08|Compositions for facilitating membrane fusion and uses thereof|

---